Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.4.24.11 (CD10)
 9,792 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
 ...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97

Neurokinin 1 (NK(1)) receptors play a fundamental role in neurogenic inflammation. We sought to determine the mechanisms downstream from NK(1) receptor (NK(1)R) activation using cDNA arrays and a novel statistical method to analyze gene expression. We used female NK(1)R(-/-) and wild-type (WT) mice that were sensitized actively by intraperitoneal injections of dinitrophenol 4 (DNP(4))-human serum albumin. Cystitis was induced by intravesical instillation of antigen of DNP(4)-ovalbumin, and control mice were challenged with saline. At 1, 4, and 24 h after instillation, bladders were removed for 1) RNA extraction (n = 3), 2) replicate of RNA extraction (n = 3), and 3) morphological analysis (n = 6). For cDNA array experiments, three bladders from each group were homogenized, and total RNA was obtained. DNase-treated RNA was reverse-transcribed to cDNA, labeled with [alpha-(32)P]dATP and hybridized to Atlas Mouse 1.2 Arrays (Clontech). After calculating the mean and SD for background spots, each experimental value was assigned a normalized score S using the formula S' = (S - Av)/SD, where S' is the original pixel value, and Av and SD are the mean and standard deviation of background spots, respectively. Only genes that expressed 3 SD values above background were used. Hypervariable genes were sorted by cluster analysis. Matrices of correlation coefficients were calculated and represented in a connectivity mosaic. As results, we found that in WT mice the most prominent gene cluster had neprilysin in a central position and positively correlated to a group of activator protein-1 (AP-1)-responsive genes, including laminin-alpha3, tissue plasminogen activator 11, fos-B, and TNF-beta. In WT mice, antigen-induced bladder inflammation led to a downregulation in neprilysin expression. In contrast, NK(1)R(-/-) mice failed to mount an inflammatory reaction and presented neprilysin negatively correlated with the same genes described in WT. In conclusion, this work indicates an overriding participation of NK(1)R and neprilysin in bladder inflammation, provides a working model for the involvement of AP-1 transcription factor, and evokes testable hypotheses regarding the role of NK(1)R and neprilysin in inflammation.
 ...
PMID:Neurokinin 1 receptors and neprilysin modulation of mouse bladder gene regulation. 1249 46

Ischemia and seizure cause excessive neuronal excitation that is associated with brain acidosis and neuronal cell death. However, the molecular mechanism of acidification-triggered neuronal injury is incompletely understood. Here, we show that asparagine endopeptidase (AEP) is activated under acidic condition, cuts SET, an inhibitor of DNase, and triggers DNA damage in brain, which is inhibited by PIKE-L. SET, a substrate of caspases, was cleaved by acidic cytosolic extract independent of caspase activation. Fractionation of the acidic cellular extract yielded AEP that is required for SET cleavage. We found that kainate provoked AEP activation and SET cleavage at N175, triggering DNA nicking in wild-type, but not AEP null, mice. PIKE-L strongly bound SET and prevented its degradation by AEP, leading to resistance of neuronal cell death. Moreover, AEP also mediated stroke-provoked SET cleavage and cell death in brain. Thus, AEP might be one of the proteinases activated by acidosis triggering neuronal injury during neuroexcitotoxicity or ischemia.
 ...
PMID:Neuroprotective actions of PIKE-L by inhibition of SET proteolytic degradation by asparagine endopeptidase. 1837 43

We have developed a polypeptide lysostaphin FRET (fluorescence resonance energy transfer) substrate (MV11F) for the endopeptidase activity of lysostaphin. Site-directed mutants of lysostaphin that abolished the killing activity against Staphylococcus aureus also completely inhibited the endopeptidase activity against the MV11 FRET substrate. Lysostaphin-producing staphylococci are resistant to killing by lysostaphin through incorporation of serine residues at positions 3 and 5 of the pentaglycine cross-bridge in their cell walls. The MV11 FRET substrate was engineered to introduce a serine residue at each of four positions of the pentaglycine target site and it was found that only a serine residue at position 3 completely inhibited cleavage. The introduction of random, natural amino acid substitutions at position 3 of the pentaglycine target site demonstrated that only a glycine residue at this position was compatible with lysostaphin cleavage of the MV11 FRET substrate. A second series of polypeptide substrates (decoys) was developed with the GFP (green fluorescent protein) domain of MV11 replaced with that of the DNase domain of colicin E9. Using a competition FRET assay, the lysostaphin endopeptidase was shown to bind to a decoy peptide containing a GGSGG cleavage site. The MV11 substrate provides a valuable system to facilitate structure/function studies of the endopeptidase activity of lysostaphin and its orthologues.
 ...
PMID:Design of a polypeptide FRET substrate that facilitates study of the antimicrobial protease lysostaphin. 1903 48