Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:3.1.6.1 (
sulfatase
)
3,205
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
In the absence of sulfur,
Chlamydomonas
reinhardtii, a unicellular green alga, increases its rate of sulfate import and synthesizes several periplasmic proteins, including an
arylsulfatase
(Ars). These changes appear to help cells acclimate to a sulfur-deficient environment. The elevated rate of sulfate import results from an increase in the capacity and affinity of the transport system for sulfate. The synthesis of Ars, a periplasmic enzyme that cleaves sulfate from aromatic compounds, enables cells to use these molecules as a source of sulfur when free sulfate is not available. To characterize the ways in which C. reinhardtii perceives changes in the sulfur status of the environment and regulates its responses to these changes, we mutagenized cells and isolated strains exhibiting aberrant accumulation of Ars activity. These mutants were characterized for Ars activity, ars mRNA accumulation, periplasmic protein accumulation, and sulfate transport activity when grown in both sulfur-sufficient and sulfur-deficient conditions. All of the mutants exhibited pleiotropic effects with respect to several of these responses. Strains harboring double mutant combinations were constructed and characterized for Ars activity and ars mRNA accumulation. From the mutant phenotypes, we inferred that both positive and negative regulatory elements were involved in the acclimation process. Both the epistatic relationships among the mutations and the effects of the lesions on the responses of C. reinhardtii to sulfur limitation distinguished these mutants from similar mutants in Neurospora crassa.
...
PMID:Mutants of Chlamydomonas with Aberrant Responses to Sulfur Deprivation. 1224 20
In higher plants, various developmental and environmental conditions enhance expression of the alternative oxidase (AOX), whereas its induction in fungi is mainly dependent on cytochrome pathway restriction and triggering by reactive oxygen species. The AOX of the unicellular green alga
Chlamydomonas
reinhardtii is encoded by two different genes, the Aox1 gene being much more transcribed than Aox2. To analyze the transcriptional regulation of Aox1, we have fused its 1.4-kb promoter region to the promoterless
arylsulfatase
(Ars) reporter gene and measured ARS enzyme activities in transformants carrying the chimeric construct. We show that the Aox1 promoter is generally unresponsive to a number of known AOX inducers, including stress agents, respiratory inhibitors, and metabolites, possibly because the AOX activity is constitutively high in the alga. In contrast, the Aox1 expression is strongly dependent on the nitrogen source, being down-regulated by ammonium and stimulated by nitrate. Inactivation of nitrate reductase leads to a further increase of expression. The stimulation by nitrate also occurs at the AOX protein and respiratory levels. A deletion analysis of the Aox1 promoter region demonstrates that a short upstream segment (-253 to +59 with respect to the transcription start site) is sufficient to ensure gene expression and regulation, but that distal elements are required for full gene expression. The observed pattern of AOX regulation points to the possible interaction between chloroplast and mitochondria in relation to a potential increase of photogenerated ATP when nitrate is used as a nitrogen source.
...
PMID:Regulation of the alternative oxidase Aox1 gene in Chlamydomonas reinhardtii. Role of the nitrogen source on the expression of a reporter gene under the control of the Aox1 promoter. 1264 91
Expression of Cah1, encoding a periplasmic carbonic anhydrase in
Chlamydomonas
reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an
arylsulfatase
reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between -293 and -231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5'-upstream region from -651 to -231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5'-upstream region of Cah1 is discussed.
...
PMID:Cis-acting elements and DNA-binding proteins involved in CO2-responsive transcriptional activation of Cah1 encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii. 1455 82
Chlamydomonas
reinhardtii acclimates to CO2-limiting stress by inducing a set of genes for a carbon-concentrating mechanism (CCM). This set includes the gene Cah1, which encodes a periplasmic carbonic anhydrase. Although physiological aspects of CO2response have been extensively studied, regulatory components, such as transcription factors involved in the acclimation, have not been well described in eukaryotic microalgae. Using an
arylsulfatase
gene driven by the Cah1 promoter, a regulatory mutant of Cah1 was isolated and named lcr1 (for low-CO2 stress response). The photosynthetic affinity for inorganic carbon of lcr1 was reduced compared with that of wild-type cells. Expression of three low-CO2-inducible genes, Cah1, Lci1, and Lci6, were regulated by LCR1 as shown by cDNA array and RNA gel blot analyses. The Lcr1 gene encodes a protein of 602 amino acids containing a single Myb domain, which binds to the Cah1-promoter region. Expression of Lcr1 was induced by lowering CO2 levels and controlled by the regulatory factor CCM1. These results suggest that LCR1 transmits the low CO2 signal to at least three CO2-responsive genes and then fully induces CCM.
...
PMID:The novel Myb transcription factor LCR1 regulates the CO2-responsive gene Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii. 1515 88
The existence of mutants at specific steps in a pathway is a valuable tool of functional genomics in an organism. Heterologous integration occurring during transformation with a selectable marker in
Chlamydomonas
(
Chlamydomonas
reinhardtii) has been used to generate an ordered mutant library. A strain, having a chimeric construct (pNia1::
arylsulfatase
gene) as a sensor of the Nia1 gene promoter activity, was transformed with a plasmid bearing the paramomycin resistance AphVIII gene to generate insertional mutants defective at regulatory steps of the nitrate assimilation pathway. Twenty-two thousand transformants were obtained and maintained in pools of 96 for further use. The mutant library was screened for the following phenotypes: insensitivity to the negative signal of ammonium, insensitivity to the positive signal of nitrate, overexpression in nitrate, and inability to use nitrate. Analyses of mutants showed that (1) the number or integrated copies of the gene marker is close to 1; (2) the probability of cloning the DNA region at the marker insertion site is high (76%); (3) insertions occur randomly; and (4) integrations at different positions and orientations of the same genomic region appeared in at least three cases. Some of the mutants analyzed were found to be affected at putative new genes related to regulatory functions, such as guanylate cyclase, protein kinase, peptidyl-prolyl isomerase, or DNA binding. The
Chlamydomonas
mutant library constructed would also be valuable to identify any other gene with a screenable phenotype.
...
PMID:Functional genomics of the regulation of the nitrate assimilation pathway in Chlamydomonas. 1566 51
Organisms exhibit a diverse set of responses when exposed to low-phosphate conditions. Some of these responses are specific for phosphorus limitation, including responses that enable cells to efficiently scavenge phosphate from internal and external stores via the production of high-affinity phosphate transporters and the synthesis of intracellular and extracellular phosphatases. Other responses are general and occur under a number of different environmental stresses, helping coordinate cellular metabolism and cell division with the growth potential of the cell. In this article, we describe the isolation and characterization of a mutant of
Chlamydomonas
reinhardtii, low-phosphate bleaching (lpb1), which dies more rapidly than wild-type cells during phosphorus limitation. The responses of this mutant to nitrogen limitation appear normal, although the strain is also somewhat more sensitive than wild-type cells to sulfur deprivation. Interestingly, depriving the cells of both nutrients simultaneously allows for sustained survival that is similar to that observed with wild-type cells. Furthermore, upon phosphorus deprivation, the lpb1 mutant, like wild-type cells, exhibits increased levels of mRNA encoding the PHOX alkaline phosphatase, the PTB2 phosphate transporter, and the regulatory element PSR1. The mutant strain is also able to synthesize the extracellular alkaline phosphatase activity upon phosphorus deprivation and the
arylsulfatase
upon sulfur deprivation, suggesting that the specific responses to phosphorus and sulfur deprivation are normal. The LPB1 gene was tagged by insertion of the ARG7 gene, which facilitated its isolation and characterization. This gene encodes a protein with strong similarity to expressed proteins in Arabidopsis (Arabidopsis thaliana) and predicted proteins in Oryza sativa and Parachlamydia. A domain in the protein contains some similarity to the superfamily of nucleotide-diphospho-sugar transferases, and it is likely to be localized to the chloroplast or mitochondrion based on programs that predict subcellular localization. While the precise catalytic role and physiological function of the putative protein is not known, it may function in some aspect of polysaccharide metabolism and/or influence phosphorus metabolism (either structural or regulatory) in a way that is critical for allowing the cells to acclimate to nutrient limitation conditions.
...
PMID:The LPB1 gene is important for acclimation of Chlamydomonas reinhardtii to phosphorus and sulfur deprivation. 1584
Antisense technology was applied to the green alga
Chlamydomonas
reinhardtiito probe the function of a novel nuclear gene encoding a chloroplast-envelope localized sulfate permease (SulP; GenBank Accession Numbers AF467891 and AF481828). Analysis showed that antiSulP transformants are impaired in sulfate uptake, a consequence of repression in the SulP gene expression. Antisense antiSulP transformants exhibited a sulfur-deprivation phenotype, strong induction of
arylsulfatase
activity, and global induction of sulfate assimilation gene expression. In sealed cultures, opposite to the wild-type control, antiSulP strains photo-evolved H2, underlining the notion of sulfate uptake limitation by the chloroplast, a slow-down in the rate of oxygen evolution, establishment of anaerobiosis due to internal respiration and spontaneous expression of the [Fe]-hydrogenase in these strains. It is concluded that antiSulP strains are promising as tools to limit the supply of sulfates to the chloroplast, leading to a down-regulation of H2O-oxidation and O2-evolution activity, to the constitutive expression of the [Fe]-hydrogenase and continuous H2-photoproduction in
Chlamydomonas
reinhardtii.Thus, antisulPstrains might permit a study of the biochemistry of H2 metabolism in this green alga under constitutive anaerobic oxygenic photosynthesis conditions.
...
PMID:Role of SulP, a nuclear-encoded chloroplast sulfate permease, in sulfate transport and H2 evolution in Chlamydomonas reinhardtii. 1604 88
The
Chlamydomonas
reinhardtii PSR1 gene is required for proper acclimation of the cells to phosphorus (P) deficiency. P-starved psr1 mutants show signs of secondary sulfur (S) starvation, exemplified by the synthesis of extracellular
arylsulfatase
and the accumulation of transcripts encoding proteins involved in S scavenging and assimilation. Epistasis analysis reveals that induction of the S-starvation responses in P-limited psr1 cells requires the regulatory protein kinase SNRK2.1, but bypasses the membrane-targeted activator, SAC1. The inhibitory kinase SNRK2.2 is necessary for repression of S-starvation responses during both nutrient-replete growth and P limitation;
arylsulfatase
activity and S deficiency-responsive genes are partially induced in the P-deficient snrk2.2 mutants and become fully activated in the P-deficient psr1snrk2.2 double mutant. During P starvation, the sac1snrk2.2 double mutants or the psr1sac1snrk2.2 triple mutants exhibit reduced
arylsulfatase
activity compared to snrk2.2 or psr1snrk2.2, respectively, but the sac1 mutation has little effect on the abundance of S deficiency-responsive transcripts in these strains, suggesting a post-transcriptional role for SAC1 in elicitation of S-starvation responses. Interestingly, P-starved psr1snrk2.2 cells bleach and die more rapidly than wild-type or psr1 strains, suggesting that activation of S-starvation responses during P deprivation is deleterious to the cell. From these results we infer that (i) P-deficient growth causes some internal S limitation, but the S-deficiency responses are normally inhibited during acclimation to P deprivation; (ii) the S-deficiency responses are not completely suppressed in P-deficient psr1 cells and consequently these cells synthesize some
arylsulfatase
and exhibit elevated levels of transcripts for S-deprivation genes; and (iii) this increased expression is controlled by regulators that modulate transcription of S-responsive genes during S-deprivation conditions. Overall, the work strongly suggests integration of the different circuits that control nutrient-deprivation responses in
Chlamydomonas
.
...
PMID:Genetic interactions between regulators of Chlamydomonas phosphorus and sulfur deprivation responses. 1908 52
The unicellular green alga
Chlamydomonas
reinhardtii adapts to anaerobic or hypoxic conditions by developing a complex fermentative metabolism including the production of molecular hydrogen by [FeFe]-hydrogenase isoform1 (HYDA1). HYDA1 transcript and hydrogenase protein accumulate in the absence of oxygen or copper (Cu). Factors regulating this differential gene expression have been unknown so far. In this study, we report on the isolation of a
Chlamydomonas
mutant strain impaired in HYDA1 gene expression by screening an insertional mutagenesis library for HYDA1 promoter activity using the
arylsulfatase
-encoding ARYLSULFATASE2 gene as a selection marker. The mutant strain has a deletion of the COPPER RESPONSE REGULATOR1 (CRR1) gene encoding for CRR1, indicating that this SQUAMOSA-PROMOTER BINDING PROTEIN (SBP) domain transcription factor is involved in the regulation of HYDA1 transcription. Treating the C. reinhardtii wild type with mercuric ions, which were shown to inhibit the binding of the SBP domain to DNA, prevented or deactivated HYDA1 gene expression. Reporter gene analyses of the HYDA1 promoter revealed that two GTAC motifs, which are known to be the cores of CRR1 binding sites, are necessary for full promoter activity in hypoxic conditions or upon Cu starvation. However, mutations of the GTAC sites had a much stronger impact on reporter gene expression in Cu-deficient cells. Electrophoretic mobility shift assays showed that the CRR1 SBP domain binds to one of the GTAC cores in vitro. These combined results prove that CRR1 is involved in HYDA1 promoter activation.
...
PMID:Differential expression of the Chlamydomonas [FeFe]-hydrogenase-encoding HYDA1 gene is regulated by the copper response regulator1. 2266 92
The model alga
Chlamydomonas
reinhardtii has been used to pioneer genetic engineering techniques for high-value protein and biofuel production from algae. To date, most studies of transgenic
Chlamydomonas
have utilized the chloroplast genome due to its ease of engineering, with a sizeable suite of reporters and well-characterized expression constructs. The advanced manipulation of algal nuclear genomes has been hampered by limited strong expression cassettes, and a lack of high-throughput reporters. We have improved upon an endogenous reporter gene - the ARS2 gene encoding an
arylsulfatase
enzyme - that was first cloned and characterized decades ago but has not been used extensively. The new construct, derived from ARS2 cDNA, expresses significantly higher levels of reporter protein and transforms more efficiently, allowing qualitative and quantitative screening using a rapid, inexpensive 96-well assay. The improved
arylsulfatase
expression cassette was used to screen a new transgene promoter from the ARG7 gene, and found that the ARG7 promoter can express the ARS2 reporter as strongly as the HSP70-RBCS2 chimeric promoter that currently ranks as the best available promoter, thus adding to the list of useful nuclear promoters. This enhanced
arylsulfatase
reporter construct improves the efficiency and ease of genetic engineering within the
Chlamydomonas
nuclear genome, with potential application to other algal strains.
...
PMID:An improved ARS2-derived nuclear reporter enhances the efficiency and ease of genetic engineering in Chlamydomonas. 2522 80
<< Previous
1
2
3
4
Next >>