Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:3.1.6.1 (sulfatase)
3,205 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Multiple deficiency disorder fibroblasts cultured in MEM-CO2 showed deficiencies of arylsulfatase A(ARS A) comparable to the deficiency in metachromatic leukodystrophy fibroblasts. However, the MSDD fibroblasts cultured in MEM-HEPES contained near normal levels of ARS A. Moreover, the enzyme from the latter fibroblasts was indistinguishable from ARS A of control fibroblasts on DEAE-cellulose chromatography, ratio of activity with several substrates, thermal inactivation, sensitivity to inhibitors, and precipitation by antiserum to human ARS A. These data support the conclusion that the ARS A genome is intact in MSDD fibroblasts and, by extension, in MSDD patients. Other sulfatases were present at levels ranging from mildly deficient to near normal but never as low as seen in the corresponding specific sulfatase deficient disorders.
...
PMID:Presence of arylsulfatase A (ARS A) in multiple sulfatase deficiency disorder fibroblasts. 2 85

An unnamed sporeforming microorganism, termed Clostridium sp. strain S2, possessing bile salt sulfatase activity was isolated from rat intestinal microflora. The microorganism was a strictly anaerobic, nonmotile, gram-negative, asaccharolytic, sporeforming rod requiring CO2, vitamin K, and taurine; the guanine-plus-cytosine content of the DNA was 40.8 mol% (Tm), and the strain was tentatively classified as an atypical Clostridium species. Sulfatase activity was specific for 3 alpha-sulfate esters of 5 alpha- and 5 beta-bile salts, leaving the 3 beta-, 7 alpha-, and 12 alpha-sulfates unchanged. Strain S2 also deconjugated tauro- and glyco-conjugated bile salts and partially reduced into the corresponding 6 alpha-hydroxy bile salts. By these reactions, alpha-muricholate and beta-muricholate were more than 80% converted into hyocholate and omega-muricholate, respectively. In addition, strain S2 produced 12 alpha-hydroxysteroid dehydrogenase converting deoxycholate into 3 alpha-hydroxy-12-oxo-5 beta-cholanoate. When strain S2 was associated with gnotobiotic rats, the fecal bile salts were more than 90% desulfated and the fecal excretion of allochenodeoxycholate was five times lower than in control rats.
...
PMID:Isolation of a rat intestinal Clostridium strain producing 5 alpha- and 5 beta-bile salt 3 alpha-sulfatase activity. 395 39

Low arylsulfatase A levels are reported in two siblings, one with a neurologic disability not typical for metachromatic leukodystrophy, the other a healthy 18-year-old female with a normal developmental history. In both individuals, arylsulfatase A levels in white blood cells were 7-8% of control values. Cultured fibroblasts gave low values (8-10% of normal) for both cerebroside sulfatase and arylsulfatase A activities. Other family members had enzyme levels consistent with heterozygote or normal status. Cerebroside sulfate loading tests of cultured fibroblasts in 199-CO2 media were normal for all family members who were tested. In MEM-HEPES media, however, cells from the two arylsulfatase A deficient siblings showed attenuated sulfolipid catabolism. Additional clinical and laboratory studies on these individuals failed to demonstrate any features suggestive of metachromatic leukodystrophy, i.e., normal nerve conduction velocities, normal sural nerve biopsy results, and normal urinary sulfatide excretion. It is concluded that the neurologic abnormalities in the one sibling are not the result of the low enzyme activity and that both individuals represent examples of pseudo arylsulfatase A deficiency (arylsulfatase A deficiency without metachromatic leukodystrophy). These results thus call into question the ability of the high-sensitivity cerebroside sulfate loading test as carried out in MEM-HEPES media to differentiate pathologically significant defects i.e., metachromatic leukodystrophy from benign "pseudo-deficiencies."
...
PMID:Impaired cerebroside sulfate hydrolysis in fibroblasts of sibs with "pseudo" arylsulfatase A deficiency without metachromatic leukodystrophy. 613 5

The characteristics of an unclassified Mycobacterium sp. isolated from three patients with Crohn's disease are presented. The organism is extremely fastidious and mycobactin dependent and may require up to 18 months of incubation for primary isolation. Colony morphology is rough. Characteristics are unlike those of any presently defined species. The isolates produced postive niacin, catalase, and 2-week arylsulfatase reactions and were susceptible to neotetrazolium chloride (1:40,000), streptomycin (2 micrograms/ml), and rifampin (0.25 micrograms/ml). Chromogenicity, nitrate reduction, quantitative catalase, Tween hydrolysis, urease, tellurite reduction, pyrazinamidase, and 3-day arylsulfatase tests were negative, and the isolates were resistant to thiophene-2-carboxylic acid hydrazide (10 micrograms/ml) and isoniazid (10 micrograms/ml). Optimum growth in broth was determined to be in 7H9 medium with Dubos oleic albumin complex, Tween 80, and mycobactin J at 37 degrees C without CO2 or agitation and in low medium depth. This Mycobacterium sp. may be a subspecies or biovariant of Mycobacterium paratuberculosis, or it may represent a new species of Mycobacterium. It is suggested that this Mycobacterium sp. may play an etiological role in some cases of Crohn's disease.
...
PMID:Characteristics of an unclassified Mycobacterium species isolated from patients with Crohn's disease. 651 78

Bile acid sulfates, formed in human and rat livers, are desulfated by the intestinal microflora. In our study we first isolated from conventional rat feces an unnamed bacterium, termed strain S1, which desulfated the 5 beta-bile salt 3 alpha-sulfates in vitro and in vivo after association with gnotobiotic rats. Strain S1 also possessed 12 alpha-hydroxysteroid dehydrogenase and bile salt-deconjugating activities. The strain was a strict anaerobic, CO2-requiring, gram-negative, sporeforming rod and was designated as belonging to the genus Clostridium. Growth was scarce in culture media, unless in the presence of 0.1% taurine, a sulfur-containing amino acid. Addition of this substance raised the number of bacteria in thioglycolate and peptone yeast media from 10(4) per ml to 10(6) to 10(7) per ml and increased the colony diameter on agar medium from 0.2 mm to 0.5 to 0.9 mm. Sulfatase activity was specific for the 5 beta-bile salt sulfates, leaving the 5 alpha-bile salt sulfates unchanged. In addition, the sulfatase activity was cell bound, and its production was dependent on the composition of the culture medium, although no minimal sulfur medium was required for sulfatase activity.
...
PMID:Isolation of a bile salt sulfatase-producing Clostridium strain from rat intestinal microflora. 705 72

Skin fibroblasts from a Japanese patient with multiple sulfatase deficiency (MSD) (Mucosulfatidosis) were studied with regard to metabolism of various sulfated compounds in vivo. Several sulfatase activities (arylsulfatases A, B and C, cholesterol sulfatase, heparin N-sulfatase) were deficient in skin fibroblasts grown in F-10 CO2 medium. The accumulation and degradation of 35S-sulfatide, 35S-mucopolysaccharides, 14C-cholesterol sulfate by MSD cells were also studied, comparing them to control, Hunter and metachromatic leukodystrophy cells. MSD fibroblasts accumulated and failed to degrade these compounds in vivo. Cholesterol sulfate was also incorporated into the control and pathological cells, and MSD cells were unable to hydrolyze cholesterol sulfate, though cholesterol sulfate is known to be hydrolyzed in the non-lysosomal subfraction. From these data it is clear that multiple enzyme deficiencies in MSD fibroblasts can be demonstrated in vivo.
...
PMID:Multiple sulfatase deficiency (mucosulfatidosis): impaired degradation of labeled sulfated compounds in cultured skin fibroblasts in vivo. 744 94

Within the framework of toxicity testing using formulated sediment, a conditioning treatment prior to toxic contamination has been examined. This preliminary step enables the bacterial colonisation of the sediment, the initiation of organic matter degradation, and the establishment of stable biological and physico-chemical conditions. The treatment involved in keeping the formulated sediment under water in conditions similar to that chosen for toxicity tests. The behaviour of a formulated sediment was compared with a natural sediment. The monitoring of physico-chemical and biological parameters of sediment and water column was carried out over a 30-day incubation in two laboratories. The parameters of pH and redox, dissolved organic carbon (DOC), NH4 and NO2, total organic carbon (TOC) were measured. The bacterial community was characterised by the determination of bacterial density, in total bacteria number or colony forming units (CFU), several exoenzymatic activities (P-glucosidase, xylosidase, leucine-amino-peptidase phosphatase and sulfatase activities), and three gas productions (CO2, N2O and CH4). The same experiment was carried out with a natural sediment. A 10- to 15-day conditioning allowed a physico-chemical stabilisation and corresponded to kinetic changes in hydrolysis activities. As compared to data of the natural sediment, the biological activity of the formulated sediment showed a different dynamic with lower activity levels. For both sediments, an important decrease of activities levels was observed after 15 days because of a substrate limitation. The work showed that a preliminary conditioning treatment of a formulated sediment provides the stabilisation of parameters that can affect toxicant bioavailability. Additional research is needed to determine the real influence of conditioning on the bioavailability of contaminants. The possible advisability of organic matter input, to maintain the sediment bacterial activity, has to be studied.
...
PMID:Chemical and bacterial changes during laboratory conditioning of formulated and natural sediments. 1199 79

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between -293 and -231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5'-upstream region from -651 to -231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5'-upstream region of Cah1 is discussed.
...
PMID:Cis-acting elements and DNA-binding proteins involved in CO2-responsive transcriptional activation of Cah1 encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii. 1455 82

Chlamydomonas reinhardtii acclimates to CO2-limiting stress by inducing a set of genes for a carbon-concentrating mechanism (CCM). This set includes the gene Cah1, which encodes a periplasmic carbonic anhydrase. Although physiological aspects of CO2response have been extensively studied, regulatory components, such as transcription factors involved in the acclimation, have not been well described in eukaryotic microalgae. Using an arylsulfatase gene driven by the Cah1 promoter, a regulatory mutant of Cah1 was isolated and named lcr1 (for low-CO2 stress response). The photosynthetic affinity for inorganic carbon of lcr1 was reduced compared with that of wild-type cells. Expression of three low-CO2-inducible genes, Cah1, Lci1, and Lci6, were regulated by LCR1 as shown by cDNA array and RNA gel blot analyses. The Lcr1 gene encodes a protein of 602 amino acids containing a single Myb domain, which binds to the Cah1-promoter region. Expression of Lcr1 was induced by lowering CO2 levels and controlled by the regulatory factor CCM1. These results suggest that LCR1 transmits the low CO2 signal to at least three CO2-responsive genes and then fully induces CCM.
...
PMID:The novel Myb transcription factor LCR1 regulates the CO2-responsive gene Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii. 1515 88

Carbonic anhydrase (CA) catalyzes the reversible hydration of carbon dioxide to hydrogen carbonate, and its role in maintaining pH balance has made it an attractive drug target. Steroidal sulfamate esters, inhibitors of the cancer drug target steroid sulfatase (STS), are sequestered in vivo by CA II in red blood cells, which may be the origin of their excellent drug properties. Understanding the structural basis of this is important for drug design. Structures of CA II complexed with 2-methoxyestradiol 3-O-sulfamate (3), 2-ethylestradiol 3,17-O,O-bis(sulfamate) (4), and 2-methoxyestradiol 17-O-sulfamate (5) are reported to 2.10, 1.85, and 1.64 A, respectively. Inhibitor 3 interacts with the active site Zn(II) ion through the 3-O-sulfamate, while inhibitors 4 and 5 bind through their 17-O-sulfamate. Comparison of the IC(50) values for CA II inhibition gave respective values of 56, 662, 2113, 169, 770, and 86 nM for estrone 3-O-sulfamate (1), 2-methoxyestradiol 3,17-O,O-bis(sulfamate) (2), 3, 4, 5, and 5'-((4H-1,2,4-triazol-4-yl)methyl)-3-chloro-2'-cyanobiphenyl-4-yl sulfamate (6), a nonsteroidal dual aromatase-sulfatase inhibitor. Inhibitors 2, 5, and 6 showed binding to a second adjacent site that is capable of binding both steroidal and nonsteroidal ligands. Examination of both IC(50) values and crystal structures suggests that 2-substituents on the steroid nucleus hinder binding via a 3-O-sulfamate, leading to coordination through a 17-O-sulfamate if present. These results underline the influence of small structural changes on affinity and mode of binding, the degree of flexibility in the design of sulfamate-based inhibitors, and suggest a strategy for inhibitors which interact with both the active site and the second adjacent binding site simultaneously that could be both potent and selective.
...
PMID:Structures of human carbonic anhydrase II/inhibitor complexes reveal a second binding site for steroidal and nonsteroidal inhibitors. 2029 40


1 2 Next >>

---