Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:3.1.31.1 (micrococcal nuclease)
2,818 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The influence of erythrocytes of different blood groups on the intestinal isoenzyme of alkaline phosphatase (EC 3.1.31.1) was investigated. Binding of the enzyme to erythrocyte membranes was demonstrated by sedimentation experiments, by enzyme electrophoresis, by gel chromatography and immunologically using a modified Coombs technique. We found that red cells of blood group A bind almost all intestinal alkaline phosphatase; erythrocytes of blood group B or O to a much lesser degree. This is in accordance with the fact that intestinal alkaline phosphatase is found more frequently in the serum of individuals of blood group O or B than in serum of persons of blood group A. We conclude that underlying the described blood group dependent differences in synthesis of intestinal alkaline phosphatase lies a mechanism involved in the regulation of the activity of intestinal alkaline phosphatase in human serum.
...
PMID:Intestinal alkaline phosphatase and the ABO blood group system--a new aspect. 744 39

The bis[(pivaloyloxy)methyl] [PIV2] derivative of 2'-deoxy-5- fluorouridine 5'-monophosphate (FdUMP) was synthesized as a potential membrane-permeable prodrug of FdUMP. The compound was designed to enter cells by passive diffusion and to revert to FdUMP after removal of the PIV groups by hydrolytic enzymes. The most convenient preparation of PIV2FdUMP was by condensation of 2'-deoxy-5-fluorouridine (FUdR) with PIV2 phosphate in the presence of triphenylphosphine and diethyl azodicarboxylate (the Mitsunobo reagent). PIV2FdUMP was stable in the pH range 1.0-4.0 (t1/2 > 100 h). It was also fairly stable at pH 7.4 (t1/2 = 40.2 h). In 0.05 M NaOH solution, however, it was rapidly degraded (t1/2 < 2 min). In the presence of hog liver carboxylate esterases, PIV2FdUMP was converted quantitatively to the mono-[(pivaloyloxy)methyl] [PIV1] analogue PIV1FdUMP. After a 24 h incubation, only trace amounts of FdUMP (1-3%) were observed, indicating that PIV1FdUMP is a poor substrate for carboxylate esterases. In mouse plasma, PIV2FdUMP was rapidly metabolized, first to PIV1FdUMP and then to FdUMP. With continued incubation, FUdR was formed, presumably due to further catabolism of FdUMP by plasma phosphatases or 5'-nucleotidases. Since PIV1FdUMP is a poor substrate for carboxylate esterase, the cleavage of the second PIV group is most likely mediated by plasma phosphodiesterases. The rate of degradation of PIV2FdUMP in the presence of acid and alkaline phosphatase, 5'-nucleotidase, or spleen phosphodiesterase was the same as that in buffer controls, indicating that the compound is not a substrate for these nucleotide catabolizing enzymes. The concentration of PIV2FdUMP and its 3'-O-acetyl ester (PIV2 3'-O-Ac-FdUMP) required to inhibit the growth of Chinese hamster ovary (CHO) cells in vitro to less than 50 cells per colony was 5 x 10(-6) M, the same as that required for 5-fluorouracil (FU). Both nucleotide prodrugs showed the same growth-inhibitory potency against a mutant CHO cell line that was 20-fold resistant to FU (CHO/FU). Administered intraperitoneally at optimal dosage for 5 consecutive days, PIV2FdUMP and PIV2 3'-O-Ac-FdUMP were as effective as FU at prolonging the life spans of mice bearing intraperitoneally implanted P388 leukemia. Both prodrugs retained full therapeutic activity against a P388 subline resistant to FU. Collectively, these data indicate that PIV2FdUMP and PIV2 3'-O-Ac-FdUMP are effective membrane-permeable prodrugs of FdUMP.
...
PMID:Synthesis and antitumor evaluation of bis[(pivaloyloxy)methyl] 2'-deoxy-5-fluorouridine 5'-monophosphate (FdUMP): a strategy to introduce nucleotides into cells. 796 51

We describe a method for obtaining radioactive fingerprints from nonradioactive ribonucleic acid. Fragments derived by T1 ribonuclease digestion of RNA are dephosphorylated with bacterial alkaline phosphatase. When these fragments are used as primers for the reaction of primer dependent polynucleotide phosphorylase with [alpha-(32)P]GDP in the presence of T1 ribonuclease the 3'-hydroxyl group of each fragment becomes phosphorylated. The degree of phosphorylation is reasonably uniform. The method has been applied to T1 ribonuclease digests of Escherichia coli tRNA(Met) (f); the oligonucleotides were further analyzed by spleen phosphodiesterase digestion. In a similar manner fingerprints of pancreatic ribonuclease digests of RNA can be obtained, when [alpha-(32)P]UDP, polynucleotide phosphorylase and pancreatic ribonuclease are used.
...
PMID:Fingerprinting nonradioactive ribonucleic acid with the aid of polynucleotide phosphorylase. 1079 69

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.
...
PMID:The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides. 1832 53

Xenobiotic-DNA adducts are used as biomarkers to assess the genotoxic effects of carcinogens. Rats were dosed with 4-aminobiphenyl (4-ABP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), or 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). DNA was isolated from the colons of vehicle and carcinogen-treated rats and digested using different nucleases and alkaline phosphatase. Deoxyribonucleoside adducts were quantified by capillary liquid chromatography-tandem mass spectrometry (LC-MS/MS) using isotope dilution methods with deuterated internal standards. Major adducts were those bound to the C8 position of deoxyguanosine. 3'- and 5'-Exonucleases were the most efficient nucleases at isolating dG-C8-ABP adducts. However, bulky adducts such as dG-C8-MeIQx and dG-C8-PhIP were better isolated using nuclease P1 rather than a combination of micrococcal nuclease and spleen phosphodiesterase. The use of DNase I enhanced the detection of all three adducts. We describe LC-MS/MS methods for DNA adduct detection and support the testing of different nucleases that increase DNA digestion efficiency and make available more DNA adducts for detection.
...
PMID:METHODS FOR AROMATIC AND HETEROCYCLIC AMINE CARCINOGEN-DNA ADDUCT ANALYSIS BY LIQUID CHROMATOGRAPHY-TANDEM MASS SPECTROMETRY. 1912 2

Nylon nucleic acids containing oligouridine nucleotides with pendent polyamide linkers and flanked by unmodified heteronucleotide sequences were prepared by DNA templated synthesis. Templation was more efficient than the single-stranded synthesis: Coupling step yields were as high as 99.2%, with up to 7 amide linkages formed in the synthesis of a molecule containing 8 modified nucleotides. Controlled digestion by calf spleen phosphodiesterase enabled the mapping of modified nucleotides in the sequences. A combination of complete degradation of nylon nucleic acids by snake venom phosphodiesterase and dephosphorylation of the resulting nucleotide fragments by bacterial alkaline phosphatase, followed by LCMS analysis, clarified the linear structure of the oligo-amide linkages. The templated synthesis strategy afforded nylon nucleic acids in the target structure and was compatible with the presence heteronucleotides. The complete digestion procedure produced a new species of DNA analogues, nylon ribonucleosides, which display nucleosides attached via a 2'-alkylthio linkage to each diamine and dicarboxylate repeat unit of the original nylon nucleic acids. The binding affinity of a nylon ribonucleoside octamer to the complementary DNA was evaluated by thermal denaturing experiments. The octamer was found to form stable duplexes with an inverse dependence on salt concentration, in contrast to the salt-dependent DNA control.
...
PMID:Templated synthesis of nylon nucleic acids and characterization by nuclease digestion. 2312 13

Mass spectrometric analyses of DNA adducts usually require enzymatic digestion of the DNA to nucleosides. The digestive enzymes used in our laboratory included a calf spleen phosphodiesterase, whose marketing was stopped recently. Using DNA adducted with bioactivated methyleugenol and 1-methoxy-3-indolylmethyl glucosinolate-each forming dA and dG adducts-we demonstrate that replacement of calf spleen phosphodiesterase (Merck) with bovine spleen phosphodiesterase (Sigma-Aldrich) leads to unchanged results. Enzyme levels used for DNA digestion are extremely variable in different studies. Therefore, we sequentially varied the level of each of the three enzymes used. All dose (enzyme)-response (adduct level) curves involved a long plateau starting below the enzyme levels employed previously. Thus, we could reduce the amounts of micrococcal nuclease, phosphodiesterase, and alkaline phosphatase for quantitative DNA digestion by factors of 4, 2, and 333, respectively, compared to our previous protocols. Moreover, we observed significant phosphatase activity of both phosphodiesterase preparations used, which may affect the recovery of adducts with methods requiring digestion to 2'-deoxynucleoside-3'-monophosphates (e.g., (32)P-postlabeling). In addition, the phosphodiesterase from Sigma-Aldrich, but not that from Merck, deaminated dA. This was irrelevant for the dA adducts studied, involving bonding at N(6), but might complicate the analysis of other dA adducts.
...
PMID:Optimized enzymatic hydrolysis of DNA for LC-MS/MS analyses of adducts of 1-methoxy-3-indolylmethyl glucosinolate and methyleugenol. 2314 29


<< Previous 1 2 3 4

---