Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.30.2 (endonuclease)
18,621 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Donor deoxyribonucleic acid strands in the eclipse phase of genetic transformation of pnuemococcus (Streptococcus pneumoniae) are purified as a complex with a cf the deoxyribonucleic acid strand in this complex to digestion by nucleases was shown to be 50- to 1,000-fold less than that of uncomplexed single strands of deoxyribonucleic acid. Deoxyribonuclease I, micrococcal nuclease, Neurospora endonuclease, nuclease P1, and the major endogenous nuclease of cell-free extracts were studied. Sensitivity to nuclease attack was not uniform along the deoxyribonucleic acid strand; sequences of strongly protected bases were separated by more sensitive regions. The minimum size of protected fragments was about 70 bases. A complex of protein with the protected deoxyribonucleic acid segments was obtained after partial digestion. The sizes of these complexes, of the protected deoxyribonucleic acid segments, and of the protein subunit released by complete nuclease digestion, are all approximately identical, as determined by gel exclusion chromatography. Deoxyribonucleic acid strands of eclipse complex were also shown to be particularly well protected from attack by the major pneumococcal endonuclease in cell extracts.
...
PMID:Transformation in pneumococcus: nuclease resistance of deoxyribonucleic acid in the eclipse complex. 4 Sep 62

In order to characterize novel human immunodeficiency virus type 1 (HIV-1) continuous epitopes, we designed a simple method, based on recombinant DNA, providing a complete set of peptides derived from HIV-1. A library (4 x 10(4) clones) was first constructed in a new expression/secretion vector, using as inserts small fragments of HIV-1 DNA (50-150 bp) generated by random DNAse I cleavage. This peptide library, expressed in the yeast Saccharomyces cerevisiae, was screened with sera of HIV-1 infected individuals and human and murine anti-HIV-1 monoclonal antibodies. Plasmids from immunoreactive colonies were recovered and the sequences of the HIV-1 derived inserts were determined. By using human sera, we have detected classical HIV-1 epitopes and identified two novel major epitopes, which may be used to improve diagnostic tests, localized in the p24 core protein and in the endonuclease. In addition, four minor epitopes were also defined by screening the library with monoclonal antibodies: in the protease, in the p17 core protein, in gp120 and near the C-terminal of gp41. This method is general and can be used for any protein from which a cloned cDNA is available.
...
PMID:A peptide library expressed in yeast reveals new major epitopes from human immunodeficiency virus type 1. 171 77

Tropomyosin polymerization is inhibited by DNAse I, an endonuclease which also interacts with G-actin. A 1:4 molar ratio of DNAse I to adult chicken pectoralis muscle tropomyosin almost completely prevents the increased viscosity of tropomyosin under polymerizing ionic conditions. While G-actin binding to DNAse I inhibits the DNAse I hydrolysis of DNA, tropomyosin does not affect this enzymatic activity. G-actin-DNAse I interaction is also not altered by tropomyosin.
...
PMID:Inhibition of muscle tropomyosin polymerization by DNAse I. 381 67

The RuvC protein of Escherichia coli is an endonuclease that specifically recognises and cleaves Holliday junctions during genetic recombination. The structure of the RuvC-Holliday junctions complex has been investigated by DNAse I footprinting and by gel electrophoretic analysis. We find that RuvC binds to the Holliday junction to form a complex that exhibits 2-fold symmetry, and in which the three-dimensional structure of the Holliday junction is altered to an unfolded form. This structure is observed in the absence or presence of divalent metal ions and differs from either the unfolded square or the folded stacked X-structures that have been observed with protein-free Holliday junctions. KMnO4 was used to probe the junction DNA upon binding by RuvC, and indicates that base-pairing at the crossover is disrupted within the RuvC-Holliday junction.
...
PMID:Structural analysis of the RuvC-Holliday junction complex reveals an unfolded junction. 767 2

Drosophila Rrp1 (Recombination repair protein 1) belongs to a family of DNA repair nucleases that includes Escherichia coli exonuclease III, Streptococcus pneumoniae exonuclease A, bovine BAP, mouse APEX endonuclease, and human APE. Within a 252 amino acid region, colinear homology is shared between all members. Rrp1 is unique in that it includes a 427 amino acid N-terminal region not related to any known sequence. The protein copurifies with an apurinic endonuclease and a double-stranded DNA 3'-exonuclease. In this study, a 5'-end-labeled 37 base pair oligonucleotide substrate containing a single apurinic site was used to characterize the endonuclease activity of Rrp1. This substrate is utilized efficiently by Rrp1: the specific activity observed is 1 x 10(5) units/mg. The abasic double-stranded DNA oligonucleotide is cleaved only at the abasic site to create a single-strand break. Strand breaks are not detected in the complementary strand, in the single-stranded DNA oligonucleotide, or in the base-paired control substrate. After endonucleolytic cleavage at the abasic site, exonucleolytic processing at the nick is slow and requires a molar excess of Rrp1, while exonuclease III degrades the nicked substrate more efficiently. The Rrp1 cleavage product comigrates with a DNaseI cleavage product, and the newly formed terminus supports DNA synthesis by DNA polymerase. Therefore, Rrp1 cleaves the phosphodiester backbone at one position 5' to the apurinic site and leaves a 3'-hydroxyl terminus. Rrp1 is a class II apurinic endonuclease and is likely to be important in DNA repair in Drosophila.
...
PMID:Characterization of the apurinic endonuclease activity of Drosophila Rrp1. 769 63

The UvrB-DNA preincision complex is a key intermediate in the repair of damaged DNA by the UvrABC endonuclease from Escherichia coli. DNaseI footprinting of this complex on DNA with a cis-[Pt(NH3)2[d(GpG)-N7(1),N7(2)]] adduct provided global information on the protein binding site on this substrate [Visse, R., et al. (1991) J. Biol. Chem. 266, 7609-7617]. By applying a method developed by Fairall and Rhodes [Fairall, L., & Rhodes, D. (1992) Nucleic Acids Res. 20, 4727-4731], who have used the size and shape of DNasI for the interpretation of a footprint, we were able to define in more detail the region where UvrB-DNA interactions in the preincision complex occur. The potential interactions with phosphate groups could be reduced to less then 14 in the damaged and to 12 in the nondamaged strand. The main UvrB-DNA interactions seem restricted to the major groove on both sides of the lesion. As a consequence UvrB crosses the minor groove just downstream of the damage. Such a binding of UvrB orients the protein away from the damage. The more detailed interpretation of UvrB-DNA interactions was supported by methylation protection experiments. The structure of the DNA in the preincision complex formed on cis-[Pt(NH3)2[GpG-N7(1),N7(2)]] is altered as could be shown diethylpyrocarbonate sensitivity of adenines just downstream of the lesion. However the adenines just downstream of another cisplatin adduct, cis-[Pt(NH3)2[d(GpCpG)-N7(1),N7(3)]], did not become diethylpyrocarbonate sensitive in the preincision complex although this complex is incision proficient.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Protein-DNA interactions and alterations in the DNA structure upon UvrB-DNA preincision complex formation during nucleotide excision repair in Escherichia coli. 806 Sep 95

Transcription of the osteocalcin gene, which encodes a 10 kDa bone-specific protein, is controlled by modularly organized basal regulatory sequences and hormone-responsive enhancer elements. We have previously shown that in the ROS 17/2.8 rat osteosarcoma cell line, which continuously expresses the osteocalcin gene, key regulatory elements reside in two DNase I hypersensitive sites that are fucntionally correlated with transcriptional activity. We now report that a specific nucleosomal organization supports this constitutive expression in ROS 17/2.8 cells, and that chromatin remodeling directly correlates with the developmentally regulated transcriptional activation of the osteocalcin gene during differentiation of normal diploid rat osteoblasts. By combining DNase I, micrococcal nuclease, and specific restriction endonuclease digestion analysis, we observed that the presence of DNAse I hypersensitive sites (-170 to -70 and -600 to -400) and a selective nucleosome positioning over the OC gene promoter are directly associated with developmental stage-specific transcriptional activation in bone-derived cells.
...
PMID:Changes in chromatin structure support constitutive and developmentally regulated transcription of the bone-specific osteocalcin gene in osteoblastic cells. 866 2

The regulation of the Sso II restriction-modification system from Shigella sonnei was studied in vivo and in vitro . In lacZ fusion experiments, Sso II methyltransferase (M. Sso II) was found to repress its own synthesis but stimulate expression of the cognate restriction endonuclease (ENase). The N-terminal 72 amino acids of M. Sso II, predicted to form a helix-turn-helix (HTH) motif, was found to be responsible for the specific DNA-binding and regulatory function of M. Sso II. Similar HTH motifs are predicted in the N-terminus of a number of 5-methylcytosine methyltransferases, particularly M. Eco RII, M.dcm and M. Msp I, of which the ability to regulate autogenously has been proposed. In vitro, the binding of M. Sso II to its target DNA was investigated using a mobility shift assay. M. Sso II forms a specific and stable complex with a 140 bp DNA fragment containing the promoter region of Sso II R-M system. The dissociation constant (Kd) was determined to be 1.5x10(-8) M. DNaseI footprinting experiments demonstrated that M. Sso II protects a 48-52 bp region immediately upstream of the M. Sso II coding sequence which includes the predicted -10 promoter sequence of M. Sso II and the -10 and -35 sequences of R. Sso II.
...
PMID:Specific binding of sso II DNA methyltransferase to its promoter region provides the regulation of sso II restriction-modification gene expression. 915 10

A rat gene, designated DNaseY, encoding a 36 kDa endonuclease was identified and cloned. Sequence analysis of the cDNA showed it to be the rat homologue of human DNAS1L3. The DNaseY gene product had 42% identity to DNaseI, including conserved critical active site residues, the essential disulfide bridge, the calcium binding domain, and a signal peptide, as well as 2 of the 3 signature boxes. Significantly, DNaseY had 2 nuclear localization signals and was more basic (pI 9.5) than DNaseI (pI 4.8). The DNaseY gene contained a number of exons similar to that of DNaseI, separated by much larger introns, resulting in a gene of >17 kb compared to <4 kb gene of DNaseI. The 36 kDa DNaseY gene product was catalytically inactive but was converted to an active 33 kDa endonuclease following processing of the hydrophobic signal peptide. Antibody generated against peptides representing the predicted amino acid sequence of DNaseY cross-reacted with a 33 kDa nuclear protein which possessed endonucleolytic activity. The enzyme was active over a broad pH range (optimum pH 7-8), was Ca2+/Mg2+-dependent, was inhibited by Zn2+, and was capable of both single- and double-stranded DNA cleavage, producing DNA fragments with 3'-OH ends. Furthermore, the DNaseY gene was expressed constitutively in all cells and tissues tested, but it was not transcriptionally up-regulated in apoptotic cells. All these features were consistent with a role in the early stages of apoptotic DNA fragmentation.
...
PMID:DNaseY: a rat DNaseI-like gene coding for a constitutively expressed chromatin-bound endonuclease. 966 19

The C gene product of the modification-restriction system PvuII binds to its own promoter (C box) and stimulates transcription of both the C gene and the endonuclease gene. According to our data the same regulatory mechanism is realized in the EcoRV system. It was found that upstream of the EcoRV endonuclease gene two ATG codons give rise to two open reading frames (ORF1 and ORF2) ending at the same point inside the endonuclease gene. Two DNA fragments corresponding to ORF1 and ORF2 were cloned, and the homogenous products of proteins encoded by them were found to be DNA-binding proteins. A specific DNA sequence (C box) recognized by the proteins was determined with DNAse I footprinting. The C box CCCATTTTGGGTTATCCCATTTTGGG is located inside ORF1 and, similar to the PvuII C box consisting of tandem repeats of 11 nucleotides, is divided by four nucleotides. In its turn each of the repeats contains inverted repeats of four terminal nucleotides. The EcoRV C box sequence differs both from the PvuII C box sequence and from the proposed consensus sequence of C boxes in other modification-restriction systems.
...
PMID:Regulatory C protein of the EcoRV modification-restriction system. 1269 83


1 2 3 Next >>