Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:3.1.30.2 (endonuclease)
18,621 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The variable positions of a branch-migrating cruciform junction in supercoiled plasmid DNA were mapped following cleavage of the DNA with bacteriophage T7 endonuclease I. T7 endonuclease I specifically cleaved, and thereby resolved, the Holliday junction existing at the base of the cruciform in the circular bacterial plasmid pSA1B.56A. Cruciform extrusion of cloned sequences in pSA1B.56A (containing a 322 base-pair inverted repeat insert composed of poxvirus telomeric sequences) topologically relaxed the plasmid substrate in vitro. Thus, numerous crossover positions were identified within the region of cloned sequences, reflecting the range of superhelical densities in the native plasmid preparation. Endonuclease I-sensitive crossover positions, mapped to both strands of the viral insert following the T7 endonuclease I digestion of either plasmid preparations or individual topoisomers, were regularly separated by approximately ten nucleotides. The appearance of sensitive crossovers every ten nucleotides corresponds to a change in linking difference (delta Lk) of +/- 2 in the circular core domain of the plasmid during branch point migration. In contrast, individual topoisomers of a plasmid preparation differ in linking number in increments of +/- 1. Thus, the observed linearization of each individual topoisomer following enzyme treatment, as a result of resolution of the crossovers associated with each topoisomer, showed that branch point migration to sensitive crossover positions must have occurred facilely. T7 endonuclease I randomly resolved across either axis of the cruciform, though some discrimination (related to the sequence specificity of the enzyme) was observed. The ten-nucleotide spacing between sensitive crossover positions is accounted for by an isomerization of the cruciform junction on branch point migration. An hypothesis is that this isomerization was imposed upon the cruciform junction by the change in helix twist (delta Tw) in the two branches that compose the topologically closed, circular domain of the plasmid. T7 endonuclease I may discriminate between the various isomeric forms and cleave a sensitive conformation that appears with every turn of branch migration which leads to the extrusion, or absorption, of two turns of helix from the circular core.
...
PMID:Conformational isomerization of the Holliday junction associated with a cruciform during branch migration in supercoiled plasmid DNA. 341 96

Previously we reported the existence of a highly polymorphic satellite, deca-satellite, in the African green monkey genome; deca-satellite probe anneals to complex sets of repeated restriction endonuclease fragments that differ from individual to individual in the monkey population. Here we present experiments aimed at clarifying the structure and organization of deca-satellite sequences and investigating the mechanisms that generate the polymorphisms. Deca-satellite represents less than 1% of the monkey genome but the percentage varies from one monkey to another. The core sequence 5'-C-C-G-G within the ten base-pair deca-satellite repeat unit is well conserved and the central 5'-C-G is sometimes but not always methylated. Restriction endonuclease analysis with BamHI and EcoRI defines separate satellite domains that have evolved in an independent manner. In situ hybridization shows deca-satellite to be located at the centromeric regions of some but not all monkey chromosomes. This location is independently confirmed by a high frequency, in monkey libraries, of segments containing junctions between deca-satellite and alpha-satellite, the main monkey centromeric satellite. The total number of metaphase chromosomes that show centromeric grains after in situ hybridization with a deca-satellite probe varies from one monkey to another. Moreover, in situ hybridization to endoreduplicated diplochromosomes showed that deca-satellite is occasionally distributed asymmetrically on one or the other of the two pairs of sister chromatids in one diplochromosome. This indicates that major reorganization of the satellite can occur frequently in somatic cells. We discuss several possible mechanisms by which deca-satellite sequences could be either amplified or deleted during a single replicative cycle. Also, on the basis of the marked fluidity of deca-satellite abundance and organization and other well-known attributes of centromeric satellites, we suggest that the existence and maintenance of centromeric satellite rests on the role of the tandem repeats themselves and not on any particular nucleotide sequence, repeat length or organization.
...
PMID:Continuous reorganization leads to extensive polymorphism in a monkey centromeric satellite. 609 31

We have examined the mitotic and meiotic properties of telomeric regions in various laboratory strains of yeast. Using a sequence (Y probe) derived from a cloned yeast telomere (J. Szostak and E. Blackburn, Cell 29:245-255, 1982), we found that various strains of Saccharomyces cerevisiae show extensive polymorphisms of restriction endonuclease fragment length. Some of the variation in the lengths of telomeric fragments appears to be under the control of a small number of genes. When DNA from various strains was digested with endonuclease KpnI, nearly all of the fragments homologous to the Y probe were found to be of different size. The pattern of fragments in different strains was extremely variable, with a greater degree of polymorphism than that observed for fragments containing the mobile TY1 element. Tetrad analysis of haploid meiotic segregants from diploids heterozygous for many different Y-homologous KpnI fragments revealed that most of them exhibited Mendelian (2:0) segregation. However, only a small proportion of these fragments displayed the obligate 2:2 parental segregation expected of simple allelic variants at the same chromosome end. From the segregations of these fragments, we concluded that some yeast telomeres lack a Y-homologous sequence and that the chromosome arms containing a Y-homologous sequence are different among various yeast strains. Regions near yeast telomeres frequently undergo rearrangement. Among eight tetrads from three different diploids, we have found three novel Y-homologous restriction fragments that appear to have arisen during meiosis. In all three cases, the appearance of a new fragment was accompanied by the loss of another band. In one of these cases, the rearrangement leading to a novel fragment arose in an isogenic diploid, in which both homologous chromosomes should have been identical. Among these same tetrads we also found examples of apparent mitotic gene conversions and mitotic recombination involving telemetric regions.
...
PMID:Rearrangements of highly polymorphic regions near telomeres of Saccharomyces cerevisiae. 639 54

Numerous selective and differential staining techniques have been used to investigate the hierarchical organisation of the human genome. This investigation demonstrates the unique characteristics that are produced on fixed human chromosomes when sequential procedures involving restriction endonuclease TaqI. distamycin A (DA) and 4',6-diamidino-2-phenylindole (DAPI) are employed. TaqI produces extensive gaps in the heterochromatic regions associated with satellite II and III DNAs of human chromosomes 1, 9, 15, 16 and Y. DA/DAPI selectively highlights, as brightly fluorescent C-bands, the heterochromatin associated with the alpha, beta, satellite II and III DNAs of these chromosomes. When DA and DAPI are used on chromosomes before TaqI digestion, and then stained with Giemsa, the centromeric regions appear to be more resistant, producing a distinct C-banding pattern and gaps in the heterochromatin regions. Sequential use of the DA/DAPI technique after TaqI treatment produces a bright fluorescence on the remaining pericentromeric regions of chromosomes 1, 9, 16 and Y, which also displayed a cytochemically unique banding pattern. This approach has produced specific enhanced chromosomal bands, which may serve as tools to characterize genomic heterochromatin at a fundamental level.
...
PMID:Counterstained enhancement of TaqI resistant sites after distamycin A/diamidinophenylindole treatment. 753 95

The terminal 240 kb of a human 2q telomere region was cloned in two overlapping yeast artificial-chromosomes (YACs). This DNA contains a region of low-copy subtelomeric repeats (within 50 kb of the 2q telomere), a segment of DNA duplicated on distal 8p23 (100 kb from the 2q telomere), and a region of single-copy DNA (230 kb from the 2q telomere). Two CpG islands are present in the DNA segment duplicated on distal 8p23. RecA-assisted restriction endonuclease cleavage of genomic DNA samples revealed a potential 55 kb chromosome length polymorphism at the 2q telomere. This work provides telomeric closure of maps for human chromosome 2q, demonstrates a novel, subtelomere-specific DNA duplication, and will permit detailed molecular and cytological studies of this human telomere region.
...
PMID:Sequence organization of the human chromosome 2q telomere. 754 74

Restriction endonuclease-resistant high-molecular-weight (HMW) DNA fragments were isolated from nuclear DNA fragments in tobacco. The size of the fragments produced by EcoRI, HindIII, AfaI, and HaeIII ranged from 20 kb to over 166 kb. The kinetics of digestion by Bal31 nuclease showed that most of the HMW fragments are chromosome ends. The consensus sequence for tobacco telomere repeats was determined to be CCCTAAA by genomic sequencing using the HMW fragments and by sequencing after cloning. Besides the telomere sequence, 9 tandem repeats of a 45-bp sequence were identified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT) formed a stem structure. The front of the stem is composed of a palindrome of the telomere repeats. This highly conserved unit is surrounded by less conserved internal sequences that are around 10-11 bp in size and contain a TTTT stretch. The internal sequences resemble the 10-11 bp consensus for the scaffold attachment regions found in yeast and drosophila. The characteristic 45-bp sequence was abundant on the ends of chromosomes. The shortest distance between the repeats containing telomeric stem and the telomere was less than 20 kb. This architecture of the tobacco chromosome end region resembles the end region of yeast chromosomes in which autonomous replication sequences are present frequently.
...
PMID:Restriction enzyme-resistant high molecular weight telomeric DNA fragments in tobacco. 758 39

Selachian chromosomes were investigated for the first time by C-, Ag- and RE (restriction endonuclease)-banding. A pair of NOR-bearing acrocentric chromosomes, as well as a third extra site, were demonstrated in two species of Torpedo. In situ digestion with restriction endonucleases revealed a peculiar arrangement of constitutive heterochromatin: in Torpedo ocellata the centromere never appeared C-banded, and was always digested by AluI, PstI, DdeI and HaeIII; in Torpedo marmorata, instead, heterochromatin was present in the centromere, and was not digested by the same enzymes. The occurrence of different types of centromeric heterochromatin suggests an involvement of highly repeated DNA fractions in the Robertsonian phenomena that occurred in chromosome rearrangements in the genus Torpedo.
...
PMID:NOR and heterochromatin analysis in two cartilaginous fishes by C-, Ag- and RE (restriction endonuclease)-banding. 758 83

DNA from a 50-kb yeast artificial chromosome (YAC) containing one human telomere was characterized. Cloned sequences from the centromeric end of this YAC (designated yRM2001) localized to several human chromosomes by somatic hybrid panel mapping. The telomeric end of the YAC contained both (TTAGGG)n sequences and the previously characterized TelBam3.4 subterminal repeat element. A novel low-copy repeat element (designated HC1103) mapped 19 kb from the telomeric end of the YAC. This repeat was shown by fluorescence in situ hybridization to be present in several subtelomeric regions (3q, 12p, 15q, 19p, and 20p) and at an interstitial site (2q13-->q14) in all individuals studied, but to be polymorphically distributed at several other telomeres. The YAC vector-insert EcoRI cloning site was positioned 50 kb to 70 kb from chromosome termini in human genomic DNA using RecA-assisted restriction endonuclease (RARE) cleavage analysis. Our results suggest that the DNA segment cloned in yRM2001 contains a novel block of low-copy DNA consistently present at some human telomeres, but polymorphically distributed at others.
...
PMID:Molecular analysis of a novel subtelomeric repeat with polymorphic chromosomal distribution. 758 96

We have examined the structure and chromatin organization of telomeres in Nicotiana tabacum. In tobacco the blocks of simple telomeric repeats (TT-TAGGG)n are many times larger than in other plants, e.g., Arabidopsis thaliana or tomato. They are resolved as multiple fragments 60-160 kb in size (in most cases 90-130 kb) on pulsed-field gel electrophoresis (PFGE) of restriction endonuclease-digested DNA. The major subtelomeric repeat of the HRS60 family forms large homogeneous blocks of a basic 180 bp motif having comparable lengths. Micrococcal nuclease (MNase) cleaves tobacco telomeric chromatin into subunits with a short repeat length of 157 +/- 5 bp; the subtelomeric heterochromatin characterized by tandemly repeated sequences of the HRS60 family is cut by MNase with a 180 bp periodicity. The monomeric and dimeric particles of telomeric and subtelomeric chromatin differ in sensitivity to MNase treatment: the telomeric particles are readily digested, producing ladders with a periodicity of 7 bp, while the subtelomeric particles appear to be rather resistant to intranucleosomal cleavage. The results presented show apparent similarities in the organization of telomeric chromatin in higher plants and mammals.
...
PMID:Organization of telomeric and subtelomeric chromatin in the higher plant Nicotiana tabacum. 760 43

The euchromatic regions of chimpanzee (Pan troglodytes) genome share approximately 98% sequence similarity with the human (Homo sapiens), while the heterochromatic regions display considerable divergence. Positive heterochromatic regions revealed by the CBG-technique are confined to pericentromeric areas in humans, while in chimpanzees, these regions are pericentromeric, telomeric, and intercalary. When human chromosomes are digested with restriction endonuclease AluI and stained by Giemsa (AluI/Giemsa), positive heterochromatin is detected only in the pericentromeric regions, while in chimpanzee, telomeric, pericentromeric, and in some chromosomes both telomeric and centromeric, regions are positive. The DA/DAPI technique further revealed extensive cytochemical heterogeneity of heterochromatin in both species. Nevertheless, the fluorescence in situ hybridization technique (FISH) using a centromeric alpha satellite cocktail probe revealed that both primates share similar pericentromeric alpha satellite DNA sequences. Furthermore, cross-hybridization experiments using chromosomes of gorilla (Gorilla gorilla) and orangutan (Pongo pygmaeus) suggest that the alphoid repeats of human and great apes are highly conserved, implying that these repeat families were present in their common ancestor. Nevertheless, the orangutan's chromosome 9 did not cross-hybridize with human probe.
...
PMID:Human (Homo sapiens) and chimpanzee (Pan troglodytes) share similar ancestral centromeric alpha satellite DNA sequences but other fractions of heterochromatin differ considerably. 772 96


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>

---