Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:3.1.30.2 (
endonuclease
)
18,621
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The yeast Kluyveromyces lactis synthesizes a beta-galactosidase (EC 3.2.1.32) which is inducible by
lactose
. We have isolated the gene that codes for this enzyme using recombinant DNA techniques. K. lactis DNA was partially digested with the restriction
endonuclease
Eco R1 and joined to Eco R1-digested pBR322 plasmid DNA using DNA ligase. ligase. A lac-mutant of Escherichia coli lacking the structural gene for beta-galactosidase was transformed with ligated DNA. Three lac+ transformants containing recombinant plasmids were selected. Two of the plasmids (pK15 and pK17) contain four Eco R1-K. lactis DNA fragments having molecular weights of 2.2, 1.4, 0.55 and 0.5 x 10(6) daltons. The other plasmid (pK16) lacks the smallest fragment. E. coli carrying any of these plasmids produce beta-galactosidase activity that has a sedimentation coefficient and immunological determinants that are nearly identical to K. lactis beta-galactosidase and distinctly different from E. coli beta-galactosidase. DNA-DNA hybridization studies show that the four Eco R1 fragments in pK15 hybridize to K. lactis but not to E. coli DNA.
...
PMID:Molecular cloning and expression in E. coli of a yeast gene coding for beta-galactosidase. 10 Feb 26
Various molecules generated by transposition of the
lactose
transposon Tn 951 from plasmid pGC1 to plasmid RP1 were examined by DNA heteroduplex and restriction
endonuclease
analysis. Tn 951 was found to transpose to at least eight different sites on RP 1 in both possible orientations. A coordinate system for the
lactose
transposon Tn 951 is constructed.
...
PMID:Multiple integration sites for the lactose transposon Tn 951 on plasmid RP 1 and establishment of a coordinate system for Tn 951. 28 15
A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type
lactose
operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction
endonuclease
. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the
lactose
operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.
...
PMID:Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators. 35 49
The technique of gene fusion, in which the gene of interest, severed from its 3' end, is in-phase fused to a reporter gene--usually lacZ--is widely used to study translational regulation in Escherichia coli. Implicit in these approaches is the assumption that the activity of the ribosome binding site (RBS) fused in-phase with lacZ, does not per se modify the steady-state level of the lacZ mRNA. Herein, we have tested this hypothesis, using a model system in which the RBS of the lamB gene is fused to lacZ. Several point mutations affecting translation initiation have been formerly characterized in this RBS, and we used Northern blots to study their effect upon the lacZ mRNA pattern. Two series of constructs were assayed: in the first one, a 51-bp fragment centered around the lamB initiator codon, was inserted in front of lacZ within the natural
lactose
operon, whereas in the second the lacZ gene was fused to the genuine malK-lamB operon just downstream from the lamB RBS. We observed that in the first series, the concentration and average molecular weight of the lacZ mRNA dropped sharply as the efficiency of the RBS decreased. This apparently arose from a decreased stability of the message, since the mRNA patterns are equalized when the
endonuclease
RNase E is inactivated. We suggest that in this case the rate limiting step in the decay process is an RNase E cleavage that is outcompeted by translation.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:The relation between translation and mRNA degradation in the lacZ gene. 172 64
A previously unreported endoribonuclease has been identified in Escherichia coli, which has a preference for hydrolysis of pyrimidine-adenosine (Pyd-Ado) bonds in RNA. It was purified about 7000-fold to give a single band after SDS/polyacrylamide gel electrophoresis; the eluted protein gave the same RNase specificity. The sizes of the native and denatured enzymes agreed suggesting that the enzyme exists as a monomer of approximately 26 kDa. It is called RNase M. The only other reported broadly specific endoribonuclease in E. coli is RNase I, a periplasmic enzyme. Based on differences in charge, heat stability and substrate specificity, it was clear that RNase M is not RNase I. The specificity of RNase M was remarkably similar to that of pancreatic RNase A even though the two enzymes differ in charge characteristics and size. Earlier studies had shown that mRNA from the
lactose
operon of E. coli is hydrolyzed in vivo primarily between Pyd-Ado bonds [Cannistraro et al. (1986) J. Mol. Biol. 192, 257-274] We propose that this major RNase activity accounts for these cleavages observed in vivo and that it is the
endonuclease
for mRNA degradation in E. coli.
...
PMID:Purification and characterization of ribonuclease M and mRNA degradation in Escherichia coli. 265 29
Genes for
lactose
catabolism and proteinase production in Streptococcus lactis 712 are encoded by a 56.5 kb metabolic plasmid, pLP712. A
lactose
mini-plasmid of only 23.7 kb, pMG820, was constructed by introducing two deletions into pLP712, and was cloned as two segments of DNA into the Escherichia coli vector pAT153 using restriction
endonuclease
PstI. The
lactose
genetic region of pLP712, which has been defined by deletion and restriction mapping, was cut into two parts by this process. When the smaller 10.8 kb segment of pMG820 DNA was present, the key lactic streptococcal
lactose
splitting enzyme, phospho-beta-D-galactosidase, was expressed in E. coli. The gene for phospho-beta-D-galactosidase was more precisely located by introducing a series of deletions into cloned DNA by in vitro manipulations and then assaying for enzyme activity. The presence of this phospho-beta-D-galactosidase activity was correlated with the production of a 58 kDa 35S-labelled protein both by E. coli minicells and after coupled transcription and translation of cloned DNA. The product of a second gene, a 37 kDa protein ('protein X'), and a possible truncated phospho-beta-D-galactosidase protein of 16 kDa were also detected in minicells.
...
PMID:Cloning, expression and location of the Streptococcus lactis gene for phospho-beta-D-galactosidase. 308 94
The phage insensitivity of Streptococcus lactis KR5 was evaluated for its possible linkage to plasmid DNA. This strain possessed plasmids of 40, 29, 26, 21, 16.5, 10.5, 7.8, and 1.5 Mdal. Plasmid curing using novobiocin resulted in derivatives with increased sensitivity to prolate-headed phage, suggesting the involvement of plasmid DNA in phage insensitivity. Transformation of S. lactis LM0230 protoplasts with the KR5 plasmid DNA pool produced transformants containing a plasmid of about 27 Mdal. These erythromycin-resistant transformants were
lactose
-positive phage-sensitive or were
lactose
-negative and exhibited a reduced sensitivity to phage. Agarose gel electrophoresis and restriction
endonuclease
digestion analysis showed the 27-Mdal plasmid band to be composed of two distinct plasmids of 26 Mdal (pBF61) and 29 Mdal (pBF62), which coded for reduced phage sensitivity and
lactose
-positive phenotypes, respectively. The mechanisms of reduced phage sensitivity encoded by pBF61 included a restriction/modification system and a mechanism that resulted in reduced plaque size independent of incubation temperature. These results further support the involvement of plasmid DNA in the mechanisms for reduced phage sensitivity in dairy streptococci.
...
PMID:Plasmid-mediated reduced phage sensitivity in Streptococcus lactis KR5. 313 85
Ropy Streptococcus (Lactococcus) cremoris strains isolated from a ropy Swedish sour milk ("longfil") and a ropy Finnish milk product ("Viili") were screened for their plasmid-encoded functions. Curing experiments strongly indicated that the ropy phenotype was linked to a 17-Md plasmid in the Swedish strains and to a 30 Md plasmid in the Finnish strains. Comparative restriction
endonuclease
analysis and DNA/DNA-hybridization studies revelated that plasmids from both strain families shared homologous DNA regions. Though be Swedish ropy strains harbored a conjugative 45-Md
lactose
plasmid, no cotransfer of the 17 Md plasmid occurred.
...
PMID:Plasmid-encoded functions of ropy lactic acid streptococcal strains from Scandinavian fermented milk. 313 63
Four small cryptic plasmids were isolated from Lactobacillus casei strains, and restriction
endonuclease
maps of these plasmids were constructed. Three of the small plasmids (pLZ18C, pLZ19E, and pLZ19F1; 6.4, 4.9, and 4.8 kilobase pairs, respectively) were cloned into Escherichia coli K-12 by using pBR322, pACYC184, and pUC8 as vectors. Two of the plasmids, pLZ18C and pLZ19E, were also cloned into Streptococcus sanguis by using pVA1 as the vector. Hybridization by using nick-translated cloned 32P-labeled L. casei plasmid DNA as the probe revealed that none of the cryptic plasmids had appreciable DNA-DNA homology with the large
lactose
plasmids found in the L. casei strains, with chromosomal DNAs isolated from these strains. Partial homology was detected among several plasmids isolated from different strains, but not among cryptic plasmids isolated from the same strain.
...
PMID:Characterization and molecular cloning of cryptic plasmids isolated from Lactobacillus casei. 392 29
The parameters affecting polyethylene glycol-induced plasmid transformation of Streptococcus lactis LM0230 protoplasts were examined to increase the transformation frequency. In contrast to spreading protoplasts over the surface of an agar medium, their incorporation into soft agar overlays enhanced regeneration of protoplasts and eliminated variability in transformation frequencies. Polyethylene glycol with a molecular weight of 3,350 at a final concentration of 22.5% yielded optimal transformation. A 20-min polyethylene glycol treatment of protoplasts in the presence of DNA was necessary for maximal transformation. The number of transformants recovered increased as the protoplast and DNA concentration increased over a range of 3.0 X 10(6) to 3.0 X 10(8) protoplasts and 0.25 to 4.0 micrograms of DNA per assay, respectively. With these parameters, transformation was increased to 5 X 10(3) to 4 X 10(4) transformants per microgram of DNA. Linear and recombinant plasmid DNA transformed, but at frequencies 10- to 100-fold lower than that of covalently closed circular DNA. Transformation of recombinant DNA molecules enabled the cloning of restriction
endonuclease
fragments coding for
lactose
metabolism into S. lactis LM0230 with the Streptococcus sanguis cloning vector, pGB301. These results demonstrated that the transformation frequency is sufficient to clone plasmid-coded genes which should prove useful for strain improvement of dairy starter cultures.
...
PMID:Plasmid transformation of Streptococcus lactis protoplasts: optimization and use in molecular cloning. 609 44
1
2
Next >>