Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:3.1.30.2 (endonuclease)
18,621 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The DNA binding activity of Fos and Jun is regulated in vitro by a post-translational mechanism involving reduction-oxidation. Redox regulation occurs through a conserved cysteine residue located in the DNA binding domain of Fos and Jun. Reduction of this residue by chemical reducing agents or by a ubiquitous nuclear redox factor (Ref-1) recently purified from Hela cells, stimulates AP-1 DNA binding activity in vitro, whereas oxidation or chemical modification of the cysteine has an inhibitory effect on DNA binding activity. Here we demonstrate that the protein product of the ref-1 gene stimulates the DNA binding activity of Fos-Jun heterodimers, Jun-Jun homodimers and Hela cell AP-1 proteins as well as that of several other transcription factors including NF-kappa B, Myb and members of the ATF/CREB family. Furthermore, immunodepletion analysis indicates that Ref-1 is the major AP-1 redox activity in Hela nuclear extracts. Interestingly, Ref-1 is a bifunctional protein; it also possesses an apurinic/apyrimidinic (AP) endonuclease DNA repair activity. However, the redox and DNA repair activities of Ref-1 can, in part, be distinguished biochemically. This study suggests a novel link between transcription factor regulation, oxidative signalling and DNA repair processes in higher eukaryotes.
...
PMID:Redox activation of Fos-Jun DNA binding activity is mediated by a DNA repair enzyme. 138 Apr 54

In order to understand the regulation of basic fibroblast growth factor (bFGF) gene expression, we have cloned and characterized the human bFGF gene and its regulatory elements. Using restriction endonuclease digestion, we have mapped the entire gene and sequenced all intron/exon boundaries to confirm authenticity and to determine organization. The data show that intron 1 is at least 16 kb long while intron 2 is 16 kb long. The human bFGF gene, including its three exons, is therefore at least 36 kb long. There are five GC boxes which may represent SP-1 binding sites and one potential AP-1 binding site within the core promoter region. Primer extension analysis indicates the presence of one bFGF-RNA transcription start site. We used a standard bacterial CAT gene expression system to identify the DNA sequence containing the functional bFGF gene promoter. Deletion analysis suggests the presence of two negative regulatory elements; one in the non-transcribed 5'-promoter region and the other within transcribed (but non-translated) sequences 3' of the promoter core.
...
PMID:Functional characterization of the human basic fibroblast growth factor gene promoter. 176 64

The cloned genomic DNA containing the human activin beta A subunit gene were analyzed by restriction endonuclease mapping, Southern blotting and DNA sequencing. The activin gene is composed of two exons interrupted by the 9-kb intron. The TATA, CCAAT and CT-stretch sequences were found in the 5'-flanking region of the gene. An intronic sequence contained SV40 enhancer core element in the vicinity of the exon 1. In the 3'-flanking region, we identified eight consensus polyadenylation sequences, five ATTTA motifs, CA element consisting of (CA)14, AP-1 binding site and two SV40 enhancer core elements. A dot matrix analysis revealed the high degree of conservation between the human and rat sequences within the 3'-flanking region, suggesting a possible functional significance.
...
PMID:Structure and sequence analysis of the human activin beta A subunit gene. 177 73

Apurinic/apyrimidinic endonuclease (APE; also referred to as Ref-1) repairs oxidative damage to DNA and regulates the redox state of DNA binding proteins. This later property influences the ability of DNA binding proteins, which include Fos and Jun, to bind to AP-1 complexes. Since DNA binding proteins may play important roles in regulating neuronal activity in the hypothalamus, we examined the expression of APE in the hypothalami of rats. In situ hybridization studies revealed high levels of APE mRNA expression in the suprachiasmatic nuclei (SCN), supraoptic nuclei (SON) and paraventricular nuclei (PVN). Since the SCN are the site of a biological clock, we examined whether APE gene expression was regulated by the circadian cycle or by light. Quantitative in situ hybridization studies showed that APE mRNA levels remained constant over the circadian cycle and were not increased by light exposure at night. We also tested if APE expression was under osmotic control in the SON and PVN. Hypertonic stimulus, however, did not induce further expression of APE mRNA in either the SON or the PVN. These findings identify the SCN, SON and PVN as sites of high level APE gene expression. These data suggest that APE may play an important role in these structures either to facilitate DNA repair or DNA binding protein action.
...
PMID:Expression of a multifunctional DNA repair enzyme gene, apurinic/apyrimidinic endonuclease (APE; Ref-1) in the suprachiasmatic, supraoptic and paraventricular nuclei. 753 93

Expression of the mammalian major apurinic/apyrimidinic (AP) endonuclease (designated as APEX nuclease, or HAP1, APE or Ref-1 gene product) during mouse brain development was investigated by in situ and northern blot hybridizations. The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities. In the embryonic and postnatal development, APEX mRNA was expressed at high levels in the proliferative zone of various brain regions, with showing temporal and spatial changes. Its expression decreased in association with brain development to the basal expression level which was observed even in adulthood, with the exception of its expression in the hippocampal formation. The growth-dependent expression of APEX gene suggests that it has some roles on cell proliferation and/or differentiation in developmental brain. Its expression on the hippocampal formation became significant from postnatal day 7 and then increased. The pyramidal and granule cell layers expressed it at a higher level than most other brain regions at postnatal day 21. The developmental change of APEX gene expression was not necessarily associated with the changes of expression of c-fos and c-jun genes measured by northern blot hybridization. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.
...
PMID:Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. 765 3

To define the mechanisms of 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced transcription of the ornithine decarboxylase (ODC) gene, we isolated a genomic clone (hODC41B) of ODC from a human leukocyte genomic DNA library. The restriction endonuclease map, in comparison with the previously published sequences of the human ODC gene, indicated that hODC41B contained a 15.7-kb sequence that extended from the sixth exon to about 10 kb upstream of the ODC gene. A 2.5-kb genomic fragment containing the 5' flanking region and the first exon was subcloned and sequenced. Sequence analysis revealed multiple putative promoter/enhancer elements (a TATA box, a CAAT box, 17 GC boxes, and a cAMP-responsive element) but no consensus AP-1 sequences (TGAGTCA) in the 2.5-kb 5' flanking region. However, three AP-1 sequences were located in introns 3, 5, and 11. We constructed a series of chimeric genes containing part of the first exon and increasingly longer 5' flanking sequences of the ODC gene fused to either bacterial chloramphenicol acetyltransferase (CAT) or luciferase reporter genes. TPA inducibility was determined by transient transfection and measurement of CAT or luciferase expression in HeLa cells. The induction of CAT activity by TPA decreased with decreasing lengths of the 5' flanking sequences up to nt -82. The TPA induction from the construct -72 ODC CAT was threefold to sevenfold, and the TPA inducibility of the same fragment was about ninefold to 30-fold with the luciferase reporter gene. Further deletion analysis revealed TPA-responsive sequences in ODC nt -42 to +54. Gel mobility shift assays using alpha-32P-end labeled ODC nt -42 to +60 revealed that nt -42 to +60 specifically bound HeLa cell nuclear proteins. HeLa cell nuclear protein binding to ODC nt -42 to +60 could not be completely competed by AP-1-, AP-2-, AP-3-, or SP1-responsive sequences.
...
PMID:Non-AP-1 tumor promoter 12-O-tetradecanoylphorbol-13-acetate-responsive sequences in the human ornithine decarboxylase gene. 804 98

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.
...
PMID:Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity. 864 73

APEX nuclease is a mammalian DNA repair enzyme having apurinic/apyrimidinic (AP) endonuclease, 3'-5'-exonuclease, DNA 3' repair diesterase and DNA 3'-phosphatase activities. It is also a redox factor (Ref-1), stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun. In the present paper, a cDNA for the enzyme was isolated from a rat brain cDNA library using mouse Apex cDNA as a probe and sequenced. The rat Apex cDNA was 1221 nucleotides (nt) long, with a 951-nt coding region. The amino acid sequence of rat APEX nuclease has 98.4% identity with mouse APEX nuclease. Using the rat Apex cDNA as a probe for Northern blot analysis, the size of rat Apex mRNA was shown to be approximately 1.5 kb. Its expression was compared in 9 rat organs on postnatal days 7 and 28. Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver. The level of expression at postnatal day 28, with the exception of the testis, was almost the same as or lower in respective organs than that at postnatal day 7. Postnatal developmental changes of Apex mRNA expression in the testis and thymus were further studied. The expression in testis was markedly increased on postnatal days 21 and 28. The expression in thymus increased once at postnatal day 14, and then decreased. The developmental changes of Apex mRNA expression in testis and thymus suggest that APEX nuclease is involved in processes such as recombinational events.
...
PMID:cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. 870 82

Plasma membrane Na+/H+ exchanger (NHE) isoforms NHE1 and NHE3 exhibit very different sensitivities to amiloride and its 5-amino-substituted analogues, benzoyl guanidinium derivatives (e.g. (3-methylsulfonyl-4-piperidinobenzoyl)guanidine methanesulfonate (HOE694)), and cimetidine. To define structural domains that confer differential sensitivity to these antagonists, unique restriction endonuclease sites were engineered into cDNAs for each isoform near the regions that encode the putative membrane-spanning domains. These new sites did not modify their pharmacological properties and allowed several chimeric Na+/H+ exchangers to be constructed by exchanging homologous segments. The modified parental (E1' and E3') and chimeric molecules were stably expressed in exchanger-deficient Chinese hamster ovary AP-1 cells and assayed for their sensitivities to amiloride, ethylisopropylamiloride, HOE694, and cimetidine. Most chimeras showed drug sensitivities corresponding to the dominant parental segment. However, interchanging a 66-amino acid segment containing the putative ninth transmembrane (M9) domain and its adjacent loops caused reciprocal alterations in the sensitivities of E1' and E3' to all antagonists. In addition, substituting the first five putative membrane-spanning domains of E3' with the corresponding region of E1' modestly reduced the transporter's sensitivity to cimetidine but not the other compounds. These data indicate that the protein segment between M8 and M10 may be a major site of interaction with these antagonists, although other regions modestly influence sensitivity to certain drugs.
...
PMID:Delineation of transmembrane domains of the Na+/H+ exchanger that confer sensitivity to pharmacological antagonists. 870 6

Locus control region (LCR) is known to occur 5'-upstream of the globin gene clusters in humans and a number of other animals. It comprises four DNase I hypersensitive sites, HS 1-4, and has been considered to play a key role in regulating the globin gene expression in tissue- and developmental stage-specific manners. The occurrence of LCR in the rat genome, however, has not been documented so far. In the present study, the author intended to identify and analyze the rat beta-LCR HS 1 and HS 2, in order to further facilitate studies on the regulatory mechanism involved in globin gene expression. The results obtained in this study are summerized as follows: 1. A DNA region of about 700 bp on the rat genome was amplified by polymerase chain reaction (PCR) using synthetic primers derived from portions of the mouse beta-LCR HS 2. The nucleotide sequence of the PCR product (R 700) shows 67% and 83% homologies with those of the human and mouse HS 2, respectively, indicating that R 700 represents beta-LCR HS 2 of rats. 2. In order to locate beta-LCR HS 2 on the rat genome, a 7 kb DNA fragment (R 7,000) harboring a region between beta-LCR HS 2 and the epsilon 1-globin gene was obtained by PCR. Restriction endonuclease mapping of R 7,000 revealed that the rat beta-LCR HS 2 is located 6.0 kb 5'-upstream relative to the cap site of the epsilon 1-globin gene. 3. The rat beta-LCR HS 1 was then located 4.2 kb 5'-upstream of the epsilon 1-globin gene by Southern blot hybridization of R 7,000 using a human HS 1 probe. Nucleotide sequencing revealed that the rat HS 1 has 83% homology to the mouse HS 1. 4. Comparisons of the structures of the rat beta-LCR HS 1 and HS 2 with those of other animal species indicate that several motifs and consensus sequences for binding of transcription factors, such as NF-E 2/AP-1 and GATA-1, are well conserved during evolutional periods, indicating an indispensable role of LCR in globin gene expression.
...
PMID:[Identification and characterization of the rat beta-globin locus control region (LCR) site 1 and site 2]. 893 14


1 2 3 Next >>

---