Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:3.1.30.1 (
S1 nuclease
)
3,660
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The translocation t(14;18) between the BCL-2 oncogene and the Ig
heavy chain
(IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an
S1 nuclease
-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.
...
PMID:Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein. 846 69
The chromosomal translocation t(14;18) in lymphoma leads to an overproduction of the Bcl-2 protein on the basis of increased Bcl-2 mRNA levels. Whereas the juxtaposition of Bcl-2 with the Ig
heavy chain
locus causes a transcriptional activation, 70% of the lymphomas also produce Bcl-2-Ig fusion RNAs with Ig 3' ends. Using
S1 nuclease
protection assays that can discriminate between nuclear RNA precursors and spliced mRNA, we found that the fusion RNAs in t(14;18) cell lines exhibit an additional posttranscriptional processing advantage. Transfection experiments with artificial genes containing various Bcl-2 or Ig 3' ends show that this effect is (1) related to RNA splicing and/or nucleocytoplasmic transport; (2) independent of transcriptional activation by the
heavy chain
enhancer; (3) dependent on the presence of the JH-CH and C-gamma1 Ig introns; and (4) tissue specific for B cells. This constitutes a novel mechanism of oncogene deregulation unrelated to transcriptional activation or half-life prolongation. The data further support the existence of a tissue-specific posttranscriptional pathway of Ig regulation in B cells.
...
PMID:The Ig heavy chain 3' end confers a posttranscriptional processing advantage to Bcl-2-IgH fusion RNA in t(14;18) lymphoma. 957 34
Antigen-stimulated B lymphocytes undergo genetic and phenotypic changes in germinal centers (GCs), including affinity maturation of immunoglobulin (Ig) genes and Ig
heavy chain
isotype switching. Expression of the Germinal Center Expressed Transcript (GCET) gene is up-regulated in murine GC B cells. The human homolog of GCET, HGAL/GCET2, is an important prognostic marker for staging lymphomas derived from GCs. To identify mechanisms that control cell type-specific transcription of GCET, we localized promoter sequences using
S1 nuclease
protection and functional assays. Sequences comprising a TATA-less promoter were localized to a short region upstream of multiple mRNA start sites. In functional assays, the promoter is active in cells irrespectively of endogenous GCET gene expression. In vitro binding assays identified a non-consensus binding site for Sp factors near sites of transcriptional initiation. The site binds Spl and Sp3 in nuclear extracts and recombinant Spl in vitro, and is required for full promoter function in transient promoter assays. Activation of the promoter by Spl or Sp3 in Spl/3-deficient cells was largely dependent on the Sp site. Together, these data provide the first analysis of regulatory modules necessary for GCET expression, a model for GC B cell-specific transcription.
...
PMID:Identification of an Sp factor-dependent promoter in GCET, a gene expressed at high levels in germinal center B cells. 1548 50
<< Previous
1
2