Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.30.1 (S1 nuclease)
 3,660 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Recurring chromosomal translocations are frequently seen in cancers, especially in leukemias and lymphomas. The genes affected by these chromosomal translocations appear to play an important role in oncogenesis. The mechanism underlying the formation of chromosomal translocation is a subject under extensive study. In chromosomal translocations involving the Ig and TCR loci, complete heptamer-spacer-nonamer signal motifs are usually present at the break of the Ig and TCR genes, indicating the involvement of V-D-J recombinase(s). On the other hand, in only about 50% of the cases signal motif sequences have been found at the break in the other participating chromosome, suggesting that different mechanisms may be involved in the scission of the corresponding chromosome. Here we report the identification of an oligopurine/oligopyrimidine DNA in the t(10;14) breakpoint cluster region associated with T-cell acute lymphoblastic leukemia. S1 nuclease mapping revealed multiple S1 hypersensitive sites in the oligopurine/oligopyrimidine DNA. These data suggest a role for oligopurine/oligopyrimidine sequences (non-B DNA) in the formation of chromosomal translocation.
 ...
PMID:S1 nuclease hypersensitive sites in an oligopurine/oligopyrimidine DNA from the t(10;14) breakpoint cluster region. 174 Dec 51

The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.
 ...
PMID:Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein. 846 69

Phenomena involving the disassembly of chromosomes to approximately 50 kbp double-stranded fragments upon protein denaturing treatments of normal and apoptotic mammalian nuclei as well as yeast protoplasts may be an indication of special, hypersensitive regions positioned regularly at loop-size intervals in the eukaryotic chromatin. Here we show evidence in yeast cell systems that loop-size fragmentation can occur in any phase of the cell cycle and that the plating efficiency of these cells is approximately 100%. The possibility of sequence specificity was investigated within the breakpoint cluster region (bcr) of the human MLL gene, frequently rearranged in certain leukemias. Our data suggest that DNA isolated from yeast cultures or mammalian cell lines carry nicks or secondary structures predisposing DNA for a specific nicking activity, at non-random positions. Furthermore, exposure of MLL bcr-carrying plasmid DNA to S1 nuclease or nuclear extracts or purified topoisomerase II elicited cleavages at the nucleotide positions of nick formation on human genomic DNA. These data support the possibility that certain sequence elements are preferentially involved in the cleavage processes responsible for the en masse disassembly of chromatin to loop-size fragments upon isolation of DNA from live eukaryotic cells.
 ...
PMID:Nick-forming sequences may be involved in the organization of eukaryotic chromatin into approximately 50 kbp loops. 1619 88

We explore the possibilities offered by flow cytometric microbead analysis to develop high throughput methods for the detection of deletions/insertions and single-strand DNA lesions. The products of PCR reactions derived from reference and test samples are denatured and reannealed, then exposed to enzymatic or chemical treatments distinguishing homoduplices from heteroduplices. The biotin- and dye labeled reaction products are immobilized on microbeads and the homo- and heteroduplices are assessed in separate fluorescence channels, by flow cytometry. Using a model system based on the mixed lineage leukemia gene breakpoint cluster region, we demonstrate that deletions and insertions in genomic DNA can be detected, using S1 nuclease and chemical cleavage to distinguish hetero- from homoduplices, or a restriction enzyme cleaving only the homoduplices. Single-strand discontinuities can also be detected, by combining nick-translation, using labeled nucleotide, and flow cytometric microbead analysis. The methodical approaches demonstrated are applicable in a versatile manner in basic cell and molecular biological research and also promise direct application for high throughput screening of genetic diseases and lesions, including insertions or deletions of short sequence elements and single-strand lesions formed at hypersensitive sites in response to apoptotic stimuli.
 ...
PMID:Heteroduplex analysis using flow cytometric microbead assays to detect deletions, insertions, and single-strand lesions. 1820 97