Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:3.1.30.1 (
S1 nuclease
)
3,660
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Three overlapping genomic clones to chick lumican were isolated and then characterized using restriction enzyme analyses, Southern blot analyses with cDNA probes, and by DNA sequencing. The results showed chick lumican gene to consist of 3 exons with a 2.9-kb first intron and a 4.2-kb second intron. Transcription initiation sites, identified by
S1 nuclease
experiments using genomic fragments containing exon 1 and by primer extension analysis of RNA, indicated the first exon to be 303 b. Two TATA sequences were 31 and 49 bases upstream of the first exon. The first exon contained all 5' untranslated sequence. The second exon was 896 b and contains 20 b of untranslated sequence, and codes for the start
methionine
to the end of the 10th leucine rich repeat. The third exon is 880 b and codes for the remainder of the core protein, and 724 b of untranslated 3' sequence. A 1-kb genomic fragment containing a portion of exon 1 and upstream sequence in a luciferase reporter sector showed specific promotor activity in the forward, but not the reverse direction when transfected into corneal fibroblasts. These results show the chick lumican gene to consist of three exons, and that regulatory elements are present within 1 kb upstream of the first exon.
...
PMID:Gene structure of chick lumican and identification of the first exon. 956 63
Sequence analysis was carried out of a human clone pBA0.6 generated after exonuclease III/
S1 nuclease
digestion and subcloning of pCMM86 (GDB: 168382, D17S74), which was not available in the database. It revealed the presence of a reiterating core motif of 24mer GTGGGTGTGTTGGAGGGGGTGAGG, present 23 times, which was GC-rich and minisatellitic in nature. Genomic blots of HaeIII-digested human DNA, when hybridized with pBA0.6, generated a ladder of bands between 29.0 kb and 2.1 kb. Hybridization analyses of 88 unrelated individuals belonging to four regions of India using this probe revealed polymorphic bands which were individual specific. The probability of identity ranged from 5.07x10(-14) in Punjabis to 2.64x10(-16) in Bengalis and was found to be 3.06x10(-16) in UPites, whereas in the case of South Indians, it was 3.9x10(-15). Three sets of isomorphic bands at 29.0 kb, 2.4 kb, and 2.1 kb were common between the individuals of all the regions and served as internal markers. The 29.0-kb band was observed to be Homo sapiens specific. Construction of dendrograms based on the UPGMA method with Jaccard's coefficient values suggested less genetic similarity/high genetic diversity in all the population groups, indicating that the samples taken were random. Maximum likelihood estimates through the bootstrap sampling method showed that Punjabis, Bengalis, and UPites formed one cluster, whereas South Indians formed a separate cluster, altogether thus showing the proximity of these three population groups compared with that from South India. A preliminary study by Northern hybridization with pBA0.6 resulted in two transcripts of 0.63 kb and 0.29 kb. This finding was corroborated with RT-PCR results where 2 amplicons, matching the expected size of two open reading frames within the minisatellite sequence, were obtained. The role of the two transcripts from the minisatellite sequence is not clear as yet, and it is probable that these messages may not get translated because of the absence of a eukaryotic Kozak sequence around the initiator
methionine
in the pBA0.6 sequence.
...
PMID:Characterization of a subcloned fragment (pBA0.6) of pCMM86 located on 17q21 and its potential use in generating an individual-specific DNA profile. 1079 45
Human Tid-1, the human homologue of the Drosophila tumor suppressor lethal (2) tumorous imaginal discs, l(2) tid gene product, is a member of the DNAJ family of proteins which serve as co-chaperones to Hsp70 proteins. Here we report the cloning and characterization of the genomic structure of the human TID1 gene (hTID1), which is located on chromosome 16p13.3. hTID1 is approximately 34 kb and is composed of 12 exons. Exon sizes vary from 64 to 232 nucleotides, with the exception of exon 12 corresponding to the 3' untranslated region of hTID1, which extends over 1.1 kb.
S1 nuclease
protection assays and primer extension experiments indicate a putative transcriptional start site 21 nucleotides upstream of the initiating
methionine
. The presumptive promoter is characterized by the lack of TATA and CAAT motifs, and a high G+C content. The 5' flanking region contains several consensus binding sites for transcription factors that regulate gene expression during tissue and organ development, such as myeloid zinc finger (MZF1), Ikaros 2 and homeodomain proteins, as well as factors implicated in cell growth and survival responses, including AP-1, PEA3, E2F and NF-kB. Three alternatively spliced variants of hTID1 are expressed in a tissue and cell-type specific manner in many of the human tissues examined. The existence of these forms needs to be considered in efforts aimed at identifying mutations in the hTID1 gene.
...
PMID:Genomic organization and expression of the human tumorous imaginal disc (TID1) gene. 1170 38
The sequence of 4118 nucleotides upstream of the putative initiator codon of the D. melanogaster Ultrabithorax protein was determined. The transcription initiation site for the corresponding mRNA was identified by
S1 nuclease
mapping and primed extension. It appears that all embryonic RNA products that encode the first protein exon are initiated approximately one kilobase upstream of the initiator
methionine
, suggesting a unique Ultrabithorax promoter. The unusually long mRNA leader is unspliced. Upstream of the initiator codon occur two additional methonine codons; the first one is followed by an open reading frame encoding a putative polypeptide of 69 amino acids. We discuss the role of the leader and 5' flanking sequences with respect to transcriptional and posttranscriptional control of Ultrabithorax gene expression.
...
PMID:The structure of the Ultrabithorax promoter of Drosophila melanogaster. 1645 77
A nuclear gene AB80 has been isolated from a phage lambda Charon 4 library of pea DNA. The sequence of the gene has been determined and it has been shown to contain an uninterrupted reading frame of 269 amino acids, corresponding to a precursor to a constituent polypeptide of the light-harvesting chlorophyll a/b-protein complex. Primer extension and
S1 nuclease
studies defined a cap site for AB80. The first
methionine
codon 3' from this site is 69 nucleotides away and is the initiating codon of the open reading frame. A "TATA" sequence occurs 31 nucleotides 5' from the cap site. A second TATA sequence is found 7 nucleotides on the 5' side of the initiating
methionine
codon and the sequences surrounding this TATA sequence are strikingly similar to those surrounding the first TATA sequence. The mature polypeptide encoded by AB80 differs by 5 amino acids from the polypeptide corresponding to a previously characterized cDNA sequence pAB96. This result is indicative of heterogeneity within the constituent polypeptides of the light-harvesting chlorophyll a/b-protein complex. The sequence Arg-Lys-Ser-Ala-Thr-Thr-Lys-Lys occurs at, or near, the NH(2)-terminus of the mature polypeptide encoded by AB80. This basic peptide is of interest because of its apparent involvement in changes in excitation-energy distribution in chloroplast membranes. Some general similarities, but no extensive sequence homology, is found on comparing the transit sequence for the precursor to the chlorophyll a/b-binding polypeptide with the transit sequences previously determined for the precursors to the small subunit of ribulose-1,5-bisphosphate carboxylase.
...
PMID:Structure and expression of a pea nuclear gene encoding a chlorophyll a/b-binding polypeptide. 1659 61
A nuclear gene encoding a light-induced transiently expressed protein that is localized in the chloroplast has been isolated from an EMBL3 library of pea DNA. The gene is a member of a multigene family. The sequence of the gene contains the complete reading frame of previously characterized cDNA clones and two introns in the 5' region of the protein coding sequence. Primer extension and
S1 nuclease
studies have defined the cap site. Two TATA boxes are found 5' to the initiating
methionine
codon. Only a limited homology is found between the presequence of the gene and transit sequences of other previously sequenced precursors. Isolated nuclei of pea have been labelled and the in vitro synthesized transcripts analysed. The results show that the light-dependent expression of the gene family is regulated at the level of transcription.
...
PMID:The structure and light-dependent transient expression of a nuclear-encoded chloroplast protein gene from pea (Pisum sativum L.). 1719 39
<< Previous
1
2
3
4
5
6