Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:3.1.3.1 (
alkaline phosphatase
)
47,916
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
When Chinese hamster V79A cells are cultured in the presence of O4-methyl-[6-3H]-thymidine the incorporation of this modified nucleoside into newly synthesised DNA is observed. The radioactivity incorporated has been identified as O4-methylthymidine by digesting the DNA to 3'-monophosphates with
spleen phosphodiesterase
followed by treatment with
alkaline phosphatase
to give O4-methylthymidine as the major radioactive product. The radioactivity associated with the latter co-chromatographs with authentic O4-methylthymidine in several chromatographic systems. Once incorporated the modified nucleoside appears to be rapidly removed from the DNA with half-life of 2-3 h. There is no evidence of demethylation of the O4-methylthymidine to give thymidine, in either the culture medium or within the cells once incorporated into DNA. Although the levels of incorporation observed are low, (being only 125 O4-methylthymidine residues per 10(8) thymidine residues at a modified nucleoside concentration of 10(-5) M), they may still be relevant as similar levels are apparently produced in the DNA of the cultured cells on treatment with biologically significant doses of carcinogenic alkylating agents.
...
PMID:The incorporation of O4-methylthymidine into V79A cell DNA when present in the cell culture medium. 727 81
The bis[(pivaloyloxy)methyl] [PIV2] derivative of 2'-deoxy-5- fluorouridine 5'-monophosphate (FdUMP) was synthesized as a potential membrane-permeable prodrug of FdUMP. The compound was designed to enter cells by passive diffusion and to revert to FdUMP after removal of the PIV groups by hydrolytic enzymes. The most convenient preparation of PIV2FdUMP was by condensation of 2'-deoxy-5-fluorouridine (FUdR) with PIV2 phosphate in the presence of triphenylphosphine and diethyl azodicarboxylate (the Mitsunobo reagent). PIV2FdUMP was stable in the pH range 1.0-4.0 (t1/2 > 100 h). It was also fairly stable at pH 7.4 (t1/2 = 40.2 h). In 0.05 M NaOH solution, however, it was rapidly degraded (t1/2 < 2 min). In the presence of hog liver carboxylate esterases, PIV2FdUMP was converted quantitatively to the mono-[(pivaloyloxy)methyl] [PIV1] analogue PIV1FdUMP. After a 24 h incubation, only trace amounts of FdUMP (1-3%) were observed, indicating that PIV1FdUMP is a poor substrate for carboxylate esterases. In mouse plasma, PIV2FdUMP was rapidly metabolized, first to PIV1FdUMP and then to FdUMP. With continued incubation, FUdR was formed, presumably due to further catabolism of FdUMP by plasma phosphatases or 5'-nucleotidases. Since PIV1FdUMP is a poor substrate for carboxylate esterase, the cleavage of the second PIV group is most likely mediated by plasma phosphodiesterases. The rate of degradation of PIV2FdUMP in the presence of acid and
alkaline phosphatase
, 5'-nucleotidase, or
spleen phosphodiesterase
was the same as that in buffer controls, indicating that the compound is not a substrate for these nucleotide catabolizing enzymes. The concentration of PIV2FdUMP and its 3'-O-acetyl ester (PIV2 3'-O-Ac-FdUMP) required to inhibit the growth of Chinese hamster ovary (CHO) cells in vitro to less than 50 cells per colony was 5 x 10(-6) M, the same as that required for 5-fluorouracil (FU). Both nucleotide prodrugs showed the same growth-inhibitory potency against a mutant CHO cell line that was 20-fold resistant to FU (CHO/FU). Administered intraperitoneally at optimal dosage for 5 consecutive days, PIV2FdUMP and PIV2 3'-O-Ac-FdUMP were as effective as FU at prolonging the life spans of mice bearing intraperitoneally implanted P388 leukemia. Both prodrugs retained full therapeutic activity against a P388 subline resistant to FU. Collectively, these data indicate that PIV2FdUMP and PIV2 3'-O-Ac-FdUMP are effective membrane-permeable prodrugs of FdUMP.
...
PMID:Synthesis and antitumor evaluation of bis[(pivaloyloxy)methyl] 2'-deoxy-5-fluorouridine 5'-monophosphate (FdUMP): a strategy to introduce nucleotides into cells. 796 51
We describe a method for obtaining radioactive fingerprints from nonradioactive ribonucleic acid. Fragments derived by T1 ribonuclease digestion of RNA are dephosphorylated with bacterial
alkaline phosphatase
. When these fragments are used as primers for the reaction of primer dependent polynucleotide phosphorylase with [alpha-(32)P]GDP in the presence of T1 ribonuclease the 3'-hydroxyl group of each fragment becomes phosphorylated. The degree of phosphorylation is reasonably uniform. The method has been applied to T1 ribonuclease digests of Escherichia coli tRNA(Met) (f); the oligonucleotides were further analyzed by
spleen phosphodiesterase
digestion. In a similar manner fingerprints of pancreatic ribonuclease digests of RNA can be obtained, when [alpha-(32)P]UDP, polynucleotide phosphorylase and pancreatic ribonuclease are used.
...
PMID:Fingerprinting nonradioactive ribonucleic acid with the aid of polynucleotide phosphorylase. 1079 69
Activities of phytase, a pH 6.0 optimum nonspecific
phosphomonoesterase
and phosphodiesterase assayed toward bis(p-nitrophenyl)phosphate (phosphodiesterase I) and against p-nitrophenylphosphorylcholine (
phosphodiesterase II
), were partially purified from mycelial extracts of Aspergillus niger AbZ4 cultivated on a molasses medium by a liquid surface fermentation method. After elimination of phosphate from the medium, 7.3- and 3.5-fold enhancements in specific activities of phytase and
phosphodiesterase II
were observed. Efficacies of mycelial protein fractions in dephosphorylating a wheat-based broiler feed were determined in vitro according to a procedure that simulated digestion in the intestinal tract of poultry. The addition of 0.052 mg of protein from fractions, each of which was high in either pH 6.0 optimum
phosphomonoesterase
, phosphodiesterase I,
phosphodiesterase II
, or phytase per gram of a feed sample resulted in the enhancement of phosphorus release by 10, 11, 27, and 88%, respectively. In the presence of an excess of commercial phytase, the addition of the mycelial fraction high in phytase increased the dephosphorylation rate by 56%. The fraction high in
phosphodiesterase II
enhanced feed dephosphorylation by 8% in the presence of an excess of commercial phytase and commercial acid phosphatase.
...
PMID:In vitro efficacies of phosphorolytic enzymes synthesized in mycelial cells of Aspergillus niger AbZ4 grown by a liquid surface fermentation. 1182 65
Phosphate transport in bacteria occurs via a phosphate specific transporter system (PSTS) that belongs to the ABC family of transporters, a multisubunit system, containing an
alkaline phosphatase
. DING proteins were characterized due to the N-terminal amino acid sequence DINGG GATL, which is highly conserved in animal and plant isolates, but more variable in microbes. Most prokaryotic homologues of the DING proteins often have some structural homology to phosphatases or periplasmic phosphate-binding proteins. In E. coli, the product of the inducible gene DinG, possesses ATP hydrolyzing helicase enzymic activity. An alkaline phosphorolytic enzyme of the PSTS system was purified to homogeneity from the thermophilic bacterium Thermus thermophilus. N-terminal sequence analysis of this protein revealed the same high degree of similarity to DING proteins especially to the human synovial stimulatory protein P205, the steroidogenesis-inducing protein and to the phosphate ABC transporter, periplasmic phosphate-binding protein, putative (P. fluorescens Pf-5). The enzyme had a molecular mass of 40 kDa on SDS/PAGE, exhibiting optimal phosphatase activity at pH 12.3 and 70 degrees C. The enzyme possessed characteristics of a DING protein, such as ATPase, ds endonuclease and 3' phosphodiesterase (
3'-exonuclease
) activities and binding to linear dsDNA, displaying helicase activity on supercoiled DNA. Purification and biochemical characterization of a T. thermophilus DING protein was achieved. The biochemical properties, N-terminal sequence similarities of this protein implied that the enzyme belongs to the PSTS family and might be involved in the DNA repair mechanism of this microorganism.
...
PMID:A DING phosphatase in Thermus thermophilus. 1749 5
Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine
spleen phosphodiesterase
and bacterial
alkaline phosphatase
revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.
...
PMID:The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides. 1832 53
Xenobiotic-DNA adducts are used as biomarkers to assess the genotoxic effects of carcinogens. Rats were dosed with 4-aminobiphenyl (4-ABP), 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx), or 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP). DNA was isolated from the colons of vehicle and carcinogen-treated rats and digested using different nucleases and
alkaline phosphatase
. Deoxyribonucleoside adducts were quantified by capillary liquid chromatography-tandem mass spectrometry (LC-MS/MS) using isotope dilution methods with deuterated internal standards. Major adducts were those bound to the C8 position of deoxyguanosine. 3'- and 5'-Exonucleases were the most efficient nucleases at isolating dG-C8-ABP adducts. However, bulky adducts such as dG-C8-MeIQx and dG-C8-PhIP were better isolated using nuclease P1 rather than a combination of micrococcal nuclease and
spleen phosphodiesterase
. The use of DNase I enhanced the detection of all three adducts. We describe LC-MS/MS methods for DNA adduct detection and support the testing of different nucleases that increase DNA digestion efficiency and make available more DNA adducts for detection.
...
PMID:METHODS FOR AROMATIC AND HETEROCYCLIC AMINE CARCINOGEN-DNA ADDUCT ANALYSIS BY LIQUID CHROMATOGRAPHY-TANDEM MASS SPECTROMETRY. 1912 2
Nylon nucleic acids containing oligouridine nucleotides with pendent polyamide linkers and flanked by unmodified heteronucleotide sequences were prepared by DNA templated synthesis. Templation was more efficient than the single-stranded synthesis: Coupling step yields were as high as 99.2%, with up to 7 amide linkages formed in the synthesis of a molecule containing 8 modified nucleotides. Controlled digestion by calf
spleen phosphodiesterase
enabled the mapping of modified nucleotides in the sequences. A combination of complete degradation of nylon nucleic acids by snake venom phosphodiesterase and dephosphorylation of the resulting nucleotide fragments by bacterial
alkaline phosphatase
, followed by LCMS analysis, clarified the linear structure of the oligo-amide linkages. The templated synthesis strategy afforded nylon nucleic acids in the target structure and was compatible with the presence heteronucleotides. The complete digestion procedure produced a new species of DNA analogues, nylon ribonucleosides, which display nucleosides attached via a 2'-alkylthio linkage to each diamine and dicarboxylate repeat unit of the original nylon nucleic acids. The binding affinity of a nylon ribonucleoside octamer to the complementary DNA was evaluated by thermal denaturing experiments. The octamer was found to form stable duplexes with an inverse dependence on salt concentration, in contrast to the salt-dependent DNA control.
...
PMID:Templated synthesis of nylon nucleic acids and characterization by nuclease digestion. 2312 13
Mass spectrometric analyses of DNA adducts usually require enzymatic digestion of the DNA to nucleosides. The digestive enzymes used in our laboratory included a calf
spleen phosphodiesterase
, whose marketing was stopped recently. Using DNA adducted with bioactivated methyleugenol and 1-methoxy-3-indolylmethyl glucosinolate-each forming dA and dG adducts-we demonstrate that replacement of calf
spleen phosphodiesterase
(Merck) with bovine
spleen phosphodiesterase
(Sigma-Aldrich) leads to unchanged results. Enzyme levels used for DNA digestion are extremely variable in different studies. Therefore, we sequentially varied the level of each of the three enzymes used. All dose (enzyme)-response (adduct level) curves involved a long plateau starting below the enzyme levels employed previously. Thus, we could reduce the amounts of micrococcal nuclease, phosphodiesterase, and
alkaline phosphatase
for quantitative DNA digestion by factors of 4, 2, and 333, respectively, compared to our previous protocols. Moreover, we observed significant phosphatase activity of both phosphodiesterase preparations used, which may affect the recovery of adducts with methods requiring digestion to 2'-deoxynucleoside-3'-monophosphates (e.g., (32)P-postlabeling). In addition, the phosphodiesterase from Sigma-Aldrich, but not that from Merck, deaminated dA. This was irrelevant for the dA adducts studied, involving bonding at N(6), but might complicate the analysis of other dA adducts.
...
PMID:Optimized enzymatic hydrolysis of DNA for LC-MS/MS analyses of adducts of 1-methoxy-3-indolylmethyl glucosinolate and methyleugenol. 2314 29
A ribonuclease which was previously shown to be located in isolated vacuoles from suspension-cultured cells of tomato (Lycopersicon esculentum L.; Abel and Glund 1986, Physiol. Plant. 66, 79-86) has been purified to near homogeneity. Purification was up to 55000-fold with a yield of about 20%. The vacuolar origin of the protein was evidenced by comparing its electrophoretic mobility, isoelectric point, pH-optimum for activity and other properties with that of the RNA-degrading activity present in isolated vacuoles. The molecular weight of the native single polypeptide chain was estimated at 17500 and 20300 by gel filtration and sedimentation analysis, respectively. The enzyme hydrolyzed only single-stranded RNA with a mode of action that was endonucleolytic. The vacuolar ribonuclease had no requirement for divalent metal ions, and did not exhibit
phosphomonoesterase
(
EC 3.1.3.1
; EC 3.1.3.2) and phosphodiesterase (EC 3.1.15.1;
EC 3.1.16.1
) activity. The specificity of the enzyme has been studied by using homopolyribonucleotides as substrates. The end-products obtained were the respective nucleoside 2':3'-cyclic monophosphates and, to minor extents, the corresponding nucleoside 3'(2')-monophosphates. According to these observations, the vacuolar ribonuclease from tomato can be classified as ribonuclease I (EC 3.1.27.1).
...
PMID:Ribonuclease in plant vacuoles: purification and molecular properties of the enzyme from cultured tomato cells. 2422 89
<< Previous
1
2
3