Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.3.1 (alkaline phosphatase)
47,916 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A photocrosslink between basic fibroblast growth factor (bFGF155) and a high affinity ssDNA oligonucleotide was characterized by positive ion electrospray ionization mass spectrometry (ESIMS). The DNA was a 61-mer oligonucleotide photoaptamer bearing seven bromodeoxyuridines, identified by in vitro selection. Specific photocrosslinking of the protein to the oligonucleotide was achieved by 308 nm XeCl excimer laser excitation. The cross-linked protein nucleic acid complex was proteolyzed with trypsin. The resulting peptide crosslink was purified by PAGE, eluted, and digested by snake venom phosphodiesterase/alkaline phosphatase. Comparison of the oligonucleotide vs. the degraded peptide crosslink by high performance liquid chromatography coupled to an electrospray ionization triple quadrupole mass spectrometer showed a single ion unique to the crosslinked material. Sequencing by collision induced dissociation (MS/MS) on a triple quadrupole mass spectrometer revealed that this ion was the nonapeptide TGQYKLGSK (residues 130-138) crosslinked to a dinucleotide at Tyr133. The MS/MS spectrum indicated sequential fragmentation of the oligonucleotide to uracil covalently attached to the nonapeptide followed by fragmentation of the peptide bonds. Tyr133 is located within the heparin binding pocket, suggesting that the in vitro selection targeted this negative ion binding region of bFGF155.
...
PMID:Mass spectral characterization of a protein-nucleic acid photocrosslink. 1063 98

Several dinucleoside polyphosphates accept cytidine-3', 5'-bisphosphate from the adenylylated donor 5'-adenylylated cytidine 5',3'-bisphosphate in the T4 RNA ligase catalyzed reaction. The 5'-adenylylated cytidine 5',3'-bisphosphate synthesized in a first step, from ATP and cytidine-3',5'-bisphosphate, is used as a substrate to transfer the cytidine-3',5'-bisphosphate residue to the 3'-OH group(s) of diguanosine tetraphosphate (Gp4G) giving rise to Gp4GpCp and pCpGp4GpCp in a ratio of approximately 10 : 1, respectively. The synthesized Gp4GpCp was characterized by treatment with snake venom phosphodiesterase and alkaline phosphatase and analysis (chromatographic position and UV spectra) of the reaction products by HPLC. The apparent Km values measured for Gp4G and 5'-adenylylated cytidine 5',3'-bisphosphate in this reaction were approximately 4 mM and 0.4 mM, respectively. In the presence of 0.5 mM ATP and 0.5 mM cytidine-3',5'-bisphosphate, the relative efficiencies of the following nucleoside(5')oligophospho(5')nucleosides as acceptors of cytidine-3',5'-bisphosphate from 5'-adenylylated cytidine 5', 3'-bisphosphate are indicated in parentheses: Gp4G (100); Gp5G (101); Ap4G (47); Ap4A (39). Gp2G, Gp3G and Xp4X were not substrates of the reaction. Dinucleotides containing two guanines and at least four inner phosphates were the preferred acceptors of cytidine-3', 5'-bisphosphate at their 3'-OH group(s).
...
PMID:Several dinucleoside polyphosphates are acceptor substrates in the T4 RNA ligase catalyzed reaction. 1071 2

A tritium derivative method for sequence analysis of polyribonucleotides is detailed, which is based on borotritide reduction of oligonucleotide-3' dialdehydes generated by controlled snake venom phosphodiesterase/alkaline phosphomonoesterase digestion and periodate treatment of time point aliquots of the incubation mixture. Radioactive oligonucleotide derivatives are resolved according to chain length by PEI-cellulose(1) anion-exchange TLC and their 3'-termini identified by techniques described in the preceding paper of this series(2). The present tritium derivative method is compared with the one described previously(2).
...
PMID:Tritium sequence analysis of oligoribonucleotides: a combination of post-labeling and thin-layer chromatographic techniques for the analysis of partial snake venom phosphodiesterase digests. 1079 93

Postsynthetic modification of an oligonucleotide with an imidazole functional group was achieved by formation of an amide bond between the functional group and a single 2'-amino-2'-deoxyuridine, d-aU, of the oligonucleotide. The succinimidyl ester of N-glutaryl-histamine was synthesized under anhydrous conditions and added to the oligonucleotide in an acetonitrile-containing buffer at pH 8.0. Formation of the conjugate was assayed by digestion with snake venom phosphodiesterase and bacterial alkaline phosphatase, followed by reversed-phase HPLC to resolve constituent nucleosides. The disappearance of a peak corresponding to d-aU and the appearance of a peak that coelutes with authentic 2'-(N-glutaryl-N'-histaminyl)-2'-deoxyuridine confirmed the formation of the conjugate. Imidazole-conjugated oligonucleotides may have utility as antisense agents capable of hydrolyzing RNA.
...
PMID:Preparation of an imidazole-conjugated oligonucleotide. 1089 82

The combination of exonuclease digestion and mass spectrometry has been widely used for sequencing oligonucleotides. During an exonuclease digestion, rapid buildup in the concentration of nucleotides produces strong signal of nucleotide cluster ions in electrospray ionization-mass spectrometry, especially for oligonucleotides with greater than 25 bases. This leads to poor signal/noise ratio in the reconstructed molecular weight spectra of late digestion products due to artifact peaks from nucleotide cluster ions. Here we report a procedure that eliminates the effect of the cluster ions. In this method, alkaline phosphatase is added with snake venom phosphodiesterase to the oligonucleotide solution to convert the interfering nucleotides into noninterfering nucleosides, and the collision-induced dissociation spectrum of the dimeric oligonucleotide at the end of the digestion is obtained to determine the sequence of the last two bases at the 5'-terminus of the oligonucleotide. With this approach, the signal/noise ratio of the reconstructed molecular weight spectrum is greatly improved for relatively large oligonucleotides, and only a single digestion is needed for sequencing.
...
PMID:Improved oligonucleotide sequencing by alkaline phosphatase and exonuclease digestions with mass spectrometry. 1123 38

The capacity of Escherichia coli poly(A) polymerase to adenylylate the 3'-OH residue of a variety of nucleosides, nucleoside 5'-phosphates and dinucleotides of the type nucleoside(5')oligophospho(5')nucleoside is described here for the first time. Using micromolar concentrations of [alpha-32P]ATP, the following nucleosides/nucleotides were found to be substrates of the reaction: guanosine, AMP, CMP, GMP, IMP, GDP, CTP, dGTP, GTP, XTP, adenosine(5')diphospho(5')adenosine (Ap2A), adenosine (5')triphospho(5')adenosine (Ap3A), adenosine(5')tetraphospho(5')adenosine (Ap4A), adenosine(5')pentaphospho(5')adenosine (Ap5A), guanosine(5')diphospho(5') guanosine (Gp2G), guanosine(5')triphospho(5')guanosine (Gp3G), guanosine(5')tetraphospho(5')guanosine (Gp4G), and guanosine(5')pentaphospho(5')guanosine (Gp5G). The synthesized products were analysed by TLC or HPLC and characterized by their UV spectra, and by treatment with alkaline phosphatase and snake venom phosphodiesterase. The presence of 1 mM GMP inhibited competitively the polyadenylylation of tRNA. We hypothesize that the type of methods used to measure polyadenylation of RNA is the reason why this novel property of E. coli poly(A) polymerase has not been observed previously.
...
PMID:Poly(A) polymerase from Escherichia coli adenylylates the 3'-hydroxyl residue of nucleosides, nucleoside 5'-phosphates and nucleoside(5')oligophospho(5')nucleosides (NpnN). 1142 92

Chromatographic behavior of whole type 1 poliovirus and phenol-extracted viral RNA on diethylaminoethyl cellulose columns, as revealed by assay of plaque-forming capacity, indicated that infectious RNA had surface properties markedly different from those of the intact virus. Infectious RNA of type 1 poliovirus and Coxsackie B1 virus was relatively resistant to heat inactivation as compared to intact virus. Kinetics of inactivation at elevated temperatures were multi-hit in character. The structure of infectious enterovirus RNA was investigated by treatment with chemical inactivating agents. Urea and guanidine as hydrogen bond-disrupting agents, and mercaptoethanol and thioglycolate as disulfide bond-disrupting agents, and combinations of these did not destroy RNA infectivity whereas hydrogen bond-disrupting treatment inactivated intact virus rapidly. RNA infectivity was not reduced by chloroform extraction alone, or by octanol extraction alone, but was reduced by chloroform-octanol extraction which failed to depolymerize RNA to an extent detectable by ultracentrifugal analysis. Infectivity of type 1 poliovirus and Coxsackie B1 virus RNA was destroyed in accordance with first order kinetics by very dilute solutions of pancreatic ribonuclease, and by purified snake venom phosphodiesterase, but not at all by bacterial alkaline phosphatase. Inactivation by venom diesterase was not accelerated by prior treatment of RNA with bacterial alkaline phosphatase. These results indicated that infectivity of enteroviral RNA resided in a single stranded structure, that a single break of a phosphodiester bond anywhere along the structure was sufficient to destroy infectivity, and that infectivity did not require a terminal phosphate group. Hydroxylamine, but not other carbonyl reagents, rapidly destroyed infectivity of intact type 1 poliovirus viral RNA without depolymerization of RNA-detectable by behavior in the analytical ultracentrifuge. With S(35)-methionine-labeled poliovirus a very small fraction of radioactivity remained in RNA preparations following phenol extraction. No evidence could be obtained to indicate that infectious enteroviral RNA was composed of subunits. RNA extracted with phenol during the course of infection of HeLa cells with type 1 poliovirus resembled RNA obtained from purified whole virus with respect to heat inactivation, hydroxylamine inactivation, chromatographic separation, susceptibility to protein denaturing agents, and ability to infect productively both naturally susceptible HeLa cells and naturally insusceptible L strain mouse cells. Intracellular production of infectious RNA paralleled intracellular maturation of whole virus and preceded it by a very short interval.
...
PMID:Enteroviral ribonucleic acid. II. Biological, physical, and chemical studies. 1371 82

A series of 8-azido- and 8-amino-substituted 2',5'-oligoadenylatyes was prepared by a uranyl-ion catalyzed polymerization of the corresponding 8-substituted adenosine phosphorimidazolide. Subsequent 5'-dephosphorylation of the resulting 5'-phosphoryl 2',5'-linked oligomers with alkaline phosphatase gave the corresponding core oligomers. The CD spectra indicated that the 8-aminoadenosine analogue of the 2',5'-linked trimer has an anti-orientation as in naturally occurring 2',5'-oligoadenylates, while 8-azido-substituted 2',5'-oligoadenylates have a syn-orientation. The 8-substituted oligomers showed enhanced resistance against digestion by snake venom phosphodiesterase. The 2',5'-linked 8-azidoadenylate trimer and tetramer displayed strong RNase L binding and activating ability, although the corresponding dimer is devoid of such activities. In contrast, very low or no RNase L binding and activating ability were observed in the 8-aminoadenosine analogue of 2',5'-oligoadenylates. Results indicate that the bulkiness and ionic character of the 8-substituting group have significant effects on the ability of these analogues to bind and activate RNase L. Furthermore, the orientation of the glycosidic base in the 2-5A analogues may change from syn to anti during binding to RNase L. The 8-azidoadenosine analogues of 2-5A will be useful tools in the photoaffinity labeling of RNase L, due to their strong RNase L binding ability. In addition, these 8-azidoadenosine compounds may be considered as candidates for experimental therapeutic agents because they have enhanced stability to enzyme degradation while retaining the ability to activate RNase L.
...
PMID:Synthesis, characterization, and biological properties of 8-azido- and 8-amino-substituted 2',5'-oligoadenylates. 1458 43

8,5'-cyclopurine-2'-deoxynucleosides in DNA are repaired by nucleotide-excision repair, and act as strong blocks to DNA polymerases, RNA polymerase II and transcription factor binding. Thus, it is important to accurately determine the level of these lesions in DNA. There is controversy in the literature regarding the ability of different enzymes to release these compounds from oligodeoxynucleotides or DNA. We used liquid chromatography/mass spectrometry (LC/MS) to investigate the ability of several enzymes to release (5'S)-8,5'-cyclo-2'-deoxyadenosine [(5'S)-cdA] from dinucleotides and oligodeoxynucleotides and from DNA. The data show that (5'S)-cdA is completely released from DNA by hydrolysis with nuclease P1, snake venom phosphodiesterase and alkaline phosphatase. The identity of the normal nucleoside 5' to the (5'S)-cdA had a significant effect on its release. Using LC/MS, we also showed that the levels of (5'S)-cdA were within an order of magnitude of those of 8-hydroxy-2'-deoxyguanosine, and three times higher than those of 8-hydroxy-2'-deoxyadenosine in pig liver DNA. Different DNA isolation methods affected the levels of the latter two lesions, but did not influence those of (5'S)-cdA. We conclude that (5'S)-cdA can be completely released from DNA by enzymic hydrolysis, and the level of (5'S)-cdA in tissue DNA is comparable to those of other oxidatively induced DNA lesions.
...
PMID:Complete release of (5'S)-8,5'-cyclo-2'-deoxyadenosine from dinucleotides, oligodeoxynucleotides and DNA, and direct comparison of its levels in cellular DNA with other oxidatively induced DNA lesions. 1521 37

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.
...
PMID:2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides. 1529 64


<< Previous 1 2 3 4 5 6 7 8 Next >>