Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.27.5 (RNase)
 17,967 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We have examined whether alterations in the growth hormone/insulin-like growth factor-1 axis play a role in the pathogenesis of psoriasis. Serum, urine, full skin biopsies, and suction blister roofs were obtained from patients with psoriasis and from healthy controls. Serum concentrations of insulin-like growth factor-1 and insulin-like growth factor binding protein-3 were measured by radioimmunoassay. Growth hormone-binding protein was measured by ligand-mediated immunofunctional assay. Growth hormone concentration in urine was measured by an immunometric assay, and growth hormone receptor-gene expression was measured by RNase protection assay or by quantitative reverse transcriptase polymerase chain reaction in total RNA isolated from epidermal suction blister roofs. Serum concentrations of insulin-like growth factor-1 (249 +/- 12 micrograms per liter, mean +/- SEM, n = 42, and 277 +/- 21 micrograms per liter, n = 9, for psoriatic patients and controls, respectively), insulin-like growth factor binding protein-3 (3.1 +/- 0.08 mg per liter, n = 42, and 3.3 +/- 0.22 mg per liter, n = 9), growth hormone-binding protein (344 +/- 65 pmol per liter, n = 10, and 311 +/- 83 pmol per liter, n = 9), urinary growth hormone excretion during 24 h (12.8 +/- 2.7 microIU per 24 h, n = 12, and 12.3 +/- 1.6 microIU per 24 h, n = 9), and epidermal growth hormone receptor gene expression [32 +/- 12 x 10(3) mRNA transcripts per microgram total RNA (involved skin), n = 11, and 47 +/- 14 x 10(3) mRNA transcripts per microgram total RNA, n = 9] were similar in patients and controls. For insulin-like growth factor-1 and insulin-like growth factor binding protein-3 the values in psoriatic patients were also similar to those in larger control groups, n = 195 and n = 400, respectively. In addition, we found no evidence of local expression of growth hormone or prolactin in full skin punch biopsies from psoriatic involved skin by reverse transcriptase polymerase chain reaction. In conclusion, our results suggest that alterations in the growth hormone/ insulin-like growth factor-1 axis do not play a major role in the pathogenesis of psoriasis.
 ...
PMID:No evidence for involvement of the growth hormone/insulin-like growth factor-1 axis in psoriasis. 934 96

Growth hormone release is under tight control by two hypothalamic hormones: growth hormone-releasing hormone and somatostatin. In addition, synthetic growth hormone secretagogues have also been shown to regulate growth hormone release through the growth hormone secretagogue receptor (GHS-R), suggesting the existence of an additional physiological regulator for growth hormone release. To understand the physiological role of the GHS-R in more detail, we mapped the expression of mRNA for the receptor by in situ hybridization and RNase protection assays using rat and human tissues. In the rat brain, the major signals were detected in multiple hypothalamic nuclei as well as in the pituitary gland. Intense signals were also observed in the dentate gyrus of the hippocampal formation. Other brain areas that displayed localized and discrete signals for the receptor include the CA2 and CA3 regions of the hippocampus, the substantia nigra, ventral tegmental area, and dorsal and median raphe nuclei. In resemblance to the results from rat brain, RNase protection assays using human tissues revealed specific signals in pituitary, hypothalamus and hippocampus. Moreover, a weak signal was noted in the pancreas. The demonstration of hypothalamic and pituitary localization of the GHS-R is consistent with its role in regulating growth hormone release. The expression of the receptor in other central and peripheral regions may implicate its involvement in additional as yet undefined physiological functions.
 ...
PMID:Distribution of mRNA encoding the growth hormone secretagogue receptor in brain and peripheral tissues. 937 45

Growth hormone (GH) secretion is altered in poorly controlled diabetic animals. However, modifications in the hypothalamic neuropeptides that control GH secretion, somatostatin and GH-releasing hormone (GHRH), as well as changes in the sensitivity of the hypothalamus and pituitary to the feedback effects of GH, are less clear. We have used RNase protection assays and in-situ hybridization to address whether the mRNA expression of GH, somatostatin and GHRH, as well as of the GH receptor (GHR) in the hypothalamus and anterior pituitary, are altered in streptozotocin-induced diabetic rats. After induction of diabetes, rats were treated with insulin twice daily for 3 weeks to obtain either poorly controlled (mean plasma glucose >300 mg/dl) or well-controlled diabetic rats. Although no significant change in pituitary GH mRNA expression was found, the hypothalamic expression of GHRH and somatostatin mRNA was reduced in poorly-controlled diabetic rats and returned to control values with normalisation of plasma glucose concentrations (P<0.0001 and P<0.002, respectively). Somatostatin mRNA expression was reduced only in the central portion of the periventricular nucleus, with no change being seen in the other areas of the periventricular nucleus or in the arcuate, suprachiasmatic or paraventricular nuclei. A significant decline in GHRH mRNA expression was observed in both the arcuate nucleus and ventromedial hypothalamus. Anterior pituitary GHR mRNA expression was significantly reduced in both well and poorly-controlled diabetic rats, while there was no change in the hypothalamus. To examine whether the evolution time of the diabetes influences these parameters, in a subsequent experiment, diabetic rats received no insulin for 2 months. A significant decline in GHRH and somatostatin mRNA expression was also observed in these rats. In addition, pituitary GH mRNA expression declined significantly in long-term diabetic rats. These results demonstrate that: (1) the expression of both GHRH and somatostatin declines specifically in anatomical areas involved in anterior pituitary hormone control; (2) GHR mRNA expression is decreased in the pituitary of diabetic rats, but not in the hypothalamus, and does not return to control values with normalisation of mean blood glucose concentrations; and (3) the evolution time of the diabetes is important for detecting some changes, including the decrease in pituitary GH mRNA expression.
 ...
PMID:Anatomically specific changes in the expression of somatostatin, growth hormone-releasing hormone and growth hormone receptor mRNA in diabetic rats. 1069 41

Growth hormone-secretagogue receptor (GHSR) RNA is known to be expressed in the hypothalamus and pituitary. Since endogenous GH secretagogue (GHS) is still unknown, the physiological role of GHS and GHSR in growth is not well understood. In this study, we have determined the effects of growth hormone in GH-releasing hormone receptor (GHRHR) and GHSR RNA expression in spontaneous Dwarf rats (SDRs) which are deficient in GH secretion, with or without GH replacement. Twenty-five-day-old SDRs received daily s.c. injection of human GH (40 microg/kg BW x 2/day) or control solution for two weeks. On day 40, the rats were sacrificed by decapitation and the pituitaries were immediately removed and quickly frozen. Total RNA was extracted from the pituitary, and mRNA coding GHSR was detected and semi-quantitated by competitive RT-PCR. Pituitaries from control SDRs showed strong GHSR RNA expression and the expression level was 5 to 10 times higher in females than in males. When GH was replaced, GHSR RNA expression greatly decreased. Pituitary GHRHR RNA expression, determined by RNase Protection Assay, was similar in male and female control animals; and was also greatly reduced in rats treated with GH when compared to the control. These results suggest that the expression of both GHSR and GHRHR is regulated by growth hormone, presumably via changes in hypothalamic GHRH and/or endogenous GHS. The apparent sexual dimorphism in GHSR indicates different regulatory effects of sex steroid in young growing SDRs.
 ...
PMID:Regulation of pituitary growth hormone-secretagogue and growth hormone-releasing hormone receptor RNA expression in young Dwarf rats. 1089 Jan 84

The hypothesis that growth hormone (GH) can affect immune responses in man has been evaluated by monitoring cytokine expression in cultures from peripheral blood mononuclear cells, by enzyme-linked immunosorbent assay (ELISA) and ribonuclease protection assay, and in tonsillar cells by ELISA. In addition to pituitary GH (GH-N), the placental form (GH-V), differing from pituitary GH by 13 amino acids has also been tested. Only few effects reached statistical significance and were in no case greater than 15%. Pituitary GH slightly reduced IL-5 production and stimulated IFN-gamma production. The latter effect was also observed with prolactin and could thus be induced through the prolactin receptor. It is proposed that GH has no strong effects on the parameters investigated, possibly as a result of redundancy in the cytokine network. Alternatively, effects on leukocytes are mediated by other tissues such as the liver or are clear only in response to stronger challenges.
 ...
PMID:Limited effects of placental and pituitary growth hormone on cytokine expression in vitro. 1102 31

Because neuroendocrine mechanisms may contribute to the antiaging effects of food restriction (FR), we measured the effect of FR on mRNAs encoding anterior pituitary (AP) tropic hormones. Slot blots or RNase protection assays were done on AP RNA from 3-, 6-, 12-, 18- and 24-mo-old male F344 rats consuming food ad libitum (AL) or food restricted (FR; to 60% of AL food intake) from 6 wk. Both AL and FR rats gained body weight during the study (P < 0.05), but FR rats weighed approximately 40% less (P < 0.0001). Messenger RNA levels were expressed in two ways, i.e., per total AP and per microgram total AP RNA. Proopiomelanocortin (POMC) mRNA/microg RNA was higher (P < 0.0005) in FR than in AL rats at all ages. Thyroid-stimulating hormone (TSH) beta mRNA declined with age (P < 0.05) in AL but not FR rats and was reduced by FR up to 12 mo (P < 0.01). Growth hormone (GH) mRNA/microg RNA declined with age (P < 0.05) in AL but not FR rats, and total GH mRNA in the AP was reduced by FR at early ages (P < 0.05). FR reduced prolactin (PRL) mRNA and its age-related increase (P < 0.0005). Levels of luteinizing hormone (LH) beta and follicle-stimulating hormone (FSH) beta mRNAs did not differ between AL and FR rats until 12 mo, but thereafter rose in FR (LH beta mRNA; P < 0.01, FSH beta mRNA; P < 0.05). Many of these changes in gene expression corroborate previously reported hormonal changes in FR rodents and mutant mice with extended life spans, and thus provide further support for the hypothesis that an altered hormonal milieu contributes to the antiaging effects of food restriction.
 ...
PMID:Food restriction differentially affects pituitary hormone mRNAs throughout the adult life span of male F344 rats. 1138 54

Growth hormone (GH) regulates the expression of many genes in the liver, and for some genes this regulation may be mediated through liver-enriched transcription factors (LETFs). As part of the long-term goal to investigate the role of LETFs in GH regulation of gene expression in the liver, in this study we determined the effect of GH administration on the expression of 10 LETFs, including hepatocyte nuclear factor (HNF)-1alpha, HNF-1beta, HNF-3alpha, HNF-3beta, HNF-3gamma, HNF-4alpha, HNF-6, CCAAT/enhancer-binding protein (C/EBP) alpha, C/EBPbeta, and albumin D-element binding protein (DBP) in the bovine liver. Eighteen non-lactating and non-pregnant Angus cows were assigned randomly to three groups (n=6 per group) and each cow received a single intramuscular injection of 500 mg slow-release recombinant bovine GH. Liver biopsy samples were taken from group 1 cows 6 h after GH administration, from group 2 cows 24 h after GH administration, and from group 3 cows 1 week after GH administration. Liver biopsies were also collected from group 3 cows 1 day before GH administration, serving as pre-GH controls. The LETF mRNAs in these liver samples were quantified using ribonuclease protection assays with probes generated from bovine LETF cDNAs cloned by standard reverse transcription-polymerase chain reaction. The levels of HNF-3gamma and HNF-6 mRNAs were higher (P< 0.05) in the cows 24 h and 1 week after GH administration than in the untreated cows or the cows 6 h after GH administration. The levels of HNF-4alpha mRNA were higher (P< 0.05) in the cows 1 week after GH administration than in the other three groups of cows. The levels of C/EBPalpha mRNA were higher (P< 0.05) in the cows 24 h after GH administration than in the untreated cows or the cows 6 h after GH administration. The levels of HNF-3alpha mRNA were higher (P< 0.05) in the cows 6 h after GH administration but were lower (P< 0.05) in the cows 24 h or 1 week after GH administration compared with those in the untreated cows. The levels of DBP mRNA were higher (P< 0.05) in the cows 6 h after GH administration but were lower (P< 0.05) in the cows 24 h after GH administration compared with those in the untreated cows. The levels of HNF-1alpha, HNF-3alpha, and C/EBPbeta mRNAs were not different (P>0.05) between groups. The expression of HNF-1beta mRNA was not detectable. Thus, the expression of six LETFs including HNF-3gamma , HNF-3beta, HNF-4alpha, HNF-6, C/EBPalpha, and DBP mRNAs in the bovine liver is regulated by GH, and these six LETFs may play a role in mediating GH regulation of gene expression in the liver. Among the 10 LETFs, the response of HNF-3gamma to GH is most significant. Cloning and sequencing the promoter region of this gene revealed multiple putative binding elements for signal transducers and activators of transcription 5 (STAT5), suggesting that GH regulation of HNF-3gamma expression in the liver may be mediated through direct binding of STAT5 to the HNF-3gamma promoter.
 ...
PMID:Growth hormone regulates the expression of hepatocyte nuclear factor-3 gamma and other liver-enriched transcription factors in the bovine liver. 1564 87

Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. Growth hormone (GH) action has its effect on linear growth and on bone remodeling and homeostasis. Recently, GH has been used to improve severe short stature caused by not only GH deficiency (GHD) but also some skeletal dysplasias including achondroplasia. To improve severe short stature, we treated the patient with 0.175 mg kg-1 week-1 of GH for 7 years. His height was improved from -4.2 SD to -3.0 SD by 1 year of GH treatment. Following treatment had given positive effects continuously on his height to -2.6 SD by 3.1 years GH medication. Then, when he was 6 years old, surgical lengthening was performed and his height reached to -2.0 SD. After the surgery, we continued GH treatment. Additional GH treatment of 3.6 more years had kept his height to -2.0 SD. However, when he was 8 years old, because there was an interruption of GH treatment, the velocity of his height was obviously decreased comparing before and during the interruption, which was calculated 3.4 and 2.2 cm/year, respectively, and the SD score was decreased to -2.1 SD. This result of total 7 years of GH treatment suggested that GH treatment significantly improved his disturbed bone growth and had also positive efficacy to keep growth rate. This result implies the connection between GH signal and RMRP gene. Additionally, GH may be considered to be an efficient treatment for CHH.
 ...
PMID:An effective case of growth hormone treatment on cartilage-hair hypoplasia. 1578 Sep 58

Growth hormone (GH) and IGF-I play important roles in wound healing during intestinal injury and inflammation, but there is also indirect evidence that locally expressed IGF-I may act to induce excessive collagen deposition, which can lead to intestinal fibrosis. Factors that dictate the balance between normal wound healing and excessive healing responses are unknown. Using RNase protection assay and in situ hybridization, we determined whether GH and/or IGF-I increase type I collagen deposition in the intestine of rats fed by total parenteral nutrition (TPN), a feeding modality used for many patients following intestinal surgery and resection. We also used an in vitro model system to confirm our in vivo effects and to directly evaluate the relative potency of GH and IGF-I on DNA synthesis and collagen deposition in intestinal myofibroblasts. Both GH and IGF-I stimulated collagen production in vivo and in vitro, and IGF-I, but not GH, stimulated DNA synthesis in vitro. In collagen production, GH was less potent than IGF-I. Suppressors of cytokine signaling (SOC) are cytokine-inducible proteins that negatively feedback to inhibit the actions of cytokines and we recently found that GH selectively upregulates SOC-2 in the intestine of TPN-fed rats. We examined whether SOC-2 may be responsible for the difference in magnitude of action of GH and IGF-I on collagen accumulation. GH, but not IGF-I, induced SOC-2 in isolated myofibroblasts, and overexpression of SOC-2 led to a suppression of GH- and IGF-I-induced collagen accumulation. SOC-2 null mice infused with IGF-I showed greater collagen gene expression compared with wild-type (WT) mice. Myofibroblasts isolated from SOC-2 null mice showed increased IGF-I-stimulated DNA synthesis compared with WT cells. Taken together, these findings suggest that SOC-2 induced by GH may play an important role in suppressing collagen accumulation and mesenchymal cell proliferation induced by GH or GH-induced IGF-I, providing a mechanism for the differing potencies of GH and IGF-I on intestinal mesenchyme and collagen synthesis.
 ...
PMID:Suppressor of cytokine signaling-2 modulates the fibrogenic actions of GH and IGF-I in intestinal mesenchymal cells. 1583 13