Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:3.1.27.5 (RNase)
17,967 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Implantation of pieces of human fetal liver and thymus into SCID mice results in the development of a human thymus-like organ, in which sustained lymphopoiesis is reproducibly observed. In this model, T cell development can be experimentally manipulated. To study the influence of thymic selection on the development of the human T cell repertoire, the T cell receptor (TCR) V beta gene repertoire of double-positive (CD4+CD8+) and single-positive (CD4+CD8- and CD4-CD8+) T cells was analyzed in the SCID-hu thymus using a multiprobe ribonuclease protection assay. TCR diversity in double-positive SCID-hu thymocytes was found to be comparable with that present in the thymus of the fetal liver donor, did not change with time, and was independent of the origin of the thymus donor. Thymic selection in SCID-hu thymus induces changes in V beta usage by the single-positive CD4+ or CD8+ T cells comparable with those previously reported for single-positive cells present in a normal human thymus. Finally, significant differences were observed in the V beta usage by CD4 or CD8 single-positive T cells that matured from genetically identical stem cells in different thymic environments. Collectively, these data suggest: first, that the generation of TCR diversity at the double-positive stage is determined by the genotype of the stem cells; and second, that polymorphic determinants expressed by thymic epithelium measurably influence the V beta repertoire of mature single-positive T cells.
...
PMID:Thymic selection of the human T cell receptor V beta repertoire in SCID-hu mice. 146 Apr 21

Murine IL-10, initially identified as a product of Th2 CD4+ T cell clones, is known to be produced by a variety of hematopoietic cells. The cellular and tissue expression of IL-10 in vivo is not known and could be relevant to understanding its functions. We examined in vivo, expression of IL-10 mRNA using RT-PCR in various normal and mutant mice and after irradiation. In addition, expression was studied during rejection of an i.p. injection of P815 tumor cells. Total RNA was extracted from whole organs; standard RT-PCR, semiquantitative PCR, and RNase protection assays were performed. In normal mice IL-10 mRNA was detectable in all tissues surveyed. Semiquantitative PCR allowed an estimation of the relative levels of IL-10 mRNA in tissues. IL-10 mRNA in spleen and kidney of nude mice and SCID mice was detectable in normal amounts. Expression of IL-10 mRNA was increased in spleen and kidney in a dose-dependent fashion after irradiation. During allogeneic stimulation IL-10 mRNA was increased in spleen and kidney as demonstrated by the PCR and RNase protection assays. In conclusion, IL-10 mRNA is detectable by PCR in many organs of normal mice and is largely T and B cell-independent. The increase of IL-10 mRNA in spleen and kidney during an intraperitoneal T cell response, at a time when IFN-gamma mRNA is known to be increased in the same organs, suggests a complex systemic interaction between IL-10 and other cytokines during rejection. Moreover, the ubiquitous tissue distribution and the increased levels of steady state IL-10 mRNA after irradiation suggest that this molecule plays a general role in the biology of all tissues and may explain some of the immunosuppressive effects of ionizing radiation.
...
PMID:Tissue distribution of IL-10 mRNA in normal mice. Evidence that a component of IL-10 expression is T and B cell-independent and increased by irradiation. 811 46

The Epstein-Barr virus (EBV)-associated B-cell lymphoproliferative disorders that arise in immunosuppressed individuals are considered to resemble EBV-transformed in vitro lymphoblastoid cell lines (LCLs) with a mature activated B-cell phenotype. In this study of human lymphoproliferative disorders in the severe combined immunodeficiency mouse model, however, we demonstrate that EBV-infected tumor cells are not LCL-like but are predominantly plasmacytoid and that this phenotype correlates with reduced expression of EBV latent genes. B-cell tumors developed within 3-6 weeks after injection of LCLs into severe combined immunodeficiency mice. The tumors and the injected LCLs were analyzed by flow cytofluorometry for B-cell differentiation and activation markers and by ribonuclease protection assay for cellular and viral gene expression. No differences in the expression of CD19 and CD21 were observed. However, a decrease in CD23, CD11a (lymphocyte function-associated antigen LFA-1), and CD58 (LFA-3) expression and an increase in CD38 (a plasma-cell-associated antigen), CD54 (intracellular adhesion molecule ICAM-1), and HLA class I in the tumor cells relative to the LCLs was observed. Two-color flow cytofluorometric analysis showed that the predominant population (> 80%) in LCLs was CD23hi/CD38lo and that the major population in LCL-derived tumors was CD23lo/CD38hi. Cell cycle analysis showed that, in contrast to actively cycling LCLs, the majority of tumor cells had exited the cell cycle and were restricted to G0/G1 phase. Finally, and most important, a reduction in mRNA for the EBV latent genes EBV nuclear antigen 2 (EBNA2) and latent membrane protein (LMP1) was observed in the tumors.
...
PMID:Plasmacytoid differentiation of Epstein-Barr virus-transformed B cells in vivo is associated with reduced expression of viral latent genes. 838 Apr 97

The expression of antiviral genes in human hematopoietic stem or progenitor cells has been proposed as a strategy for gene therapy of AIDS. To be successful, this strategy requires safe and efficient transfer of the therapeutic gene into hematopoietic cells and gene expression has to be maintained in HIV susceptible cells following differentiation. We have used retroviral vectors to transfer the gene for a transdominant inhibitor of HIV replication (RevM10) into CD34+ stem/progenitor cells isolated from human umbilical cord blood (UCB). Following transduction, cells were allowed to differentiate either in vitro in clonogenic assays and long-term stromal cell cultures or in human thymus implanted in immunodeficient scid/scid mice in vivo (SCID-hu). Following differentiation and expansion, multiple lineages of cells were shown to carry the transgene. A higher percentage of gene-marked progenitor cells (10-30% in most cases) were detected in methylcellulose colony assays and in long-term stromal cell cultures (1-5%). In contrast, gene-marked T cells derived from transduced CD34+ cells in a SCID-hu model were detected at an even lower frequency (0.01-1%). RevM10 RNA expression was detected in CD34+ cells immediately after transduction and was maintained after in vitro differentiation of those cells into CD14+ myeloid cells. In T cells, the RevM10-specific RNA was detectable by RT-PCR and also by semiquantitative RNase protection. These findings demonstrate that LTR-driven gene expression is sustained in relevant cells derived from retrovirus-transduced hematopoietic progenitor cells after extensive differentiation in vitro and in vivo and suggest that stringent in vivo, rather than in vitro assays, may be a better preclinical system to improve gene marking and expression in hematopoietic cells.
...
PMID:Sustained retroviral gene marking and expression in lymphoid and myeloid cells derived from transduced hematopoietic progenitor cells. 885 97

In this study, the efficacy of an anti-ras ribozyme in reversing a transformed phenotype was investigated. A murine NIH/3T3-derived cell line, designated 2-12, contains an inducible Ha-ras oncogene, which is regulated by the Escherichia coli (E. coli) lac operator/repressor system, and displays a transformed phenotype after isopropyl-beta-D-thiogalactoside induction. To reverse the transformed characteristics, the ribozyme, which specifically targets the Ha-ras oncogene at the codon 12 mutation site (GGC to GUC), was transfected into 2-12 cells. Two (ribZ4 and ribZ7) clones were subsequently selected and analyzed for their transforming features. Our results show that, in the transfectants, ribozyme gene expression was detected, and the target Ha-ras transgene was expressed at basal levels. Their phenotypic responses, including morphology, cell growth rate, colony-formation efficiency and tumorigenicity in mice with severe combined immunodeficiency were more similar to those of NIH/3T3 than 2-12 transformed cells. Directly injecting the ribozyme DNA into tumors induced by transformed 2-12 cells in BALB/c mice also caused tumor regression. The enzymatic cleavage products of the ribozyme acting on mutant Ha-ras mRNA in vivo were detected by primer-extension analysis. These results indicate that the ribozyme were designed exhibits a site-specific ribonuclease function that effectively abrogates Ha-ras-oncogene-induced transformation, and this unique anti-Ha-ras property should shed light on the development of strategies against the Ha-ras-oncogene-initiated malignancy.
...
PMID:A ribozyme specifically suppresses transformation and tumorigenicity of Ha-ras-oncogene-transformed NIH/3T3 cell lines. 903 Feb 47

Sendai virus (SeV) is highly pathogenic for mice. In contrast, mice (including SCID mice) infected with simian virus 5 (SV5) showed no overt signs of disease. Evidence is presented that a major factor which prevented SV5 from productively infecting mice was its inability to circumvent the interferon (IFN) response in mice. Thus, in murine cells that produce and respond to IFN, SV5 protein synthesis was rapidly switched off. In marked contrast, once SeV protein synthesis began, it continued, even if the culture medium was supplemented with alpha/beta IFN (IFN-alpha/beta). However, in human cells, IFN-alpha/beta did not inhibit the replication of either SV5 or SeV once virus protein synthesis was established. To begin to address the molecular basis for these observations, the effects of SeV and SV5 infections on the activation of an IFN-alpha/beta-responsive promoter and on that of the IFN-beta promoter were examined in transient transfection experiments. The results demonstrated that (i) SeV, but not SV5, inhibited an IFN-alpha/beta-responsive promoter in murine cells; (ii) both SV5 and SeV inhibited the activation of an IFN-alpha/beta-responsive promoter in human cells; and (iii) in both human and murine cells, SeV was a strong inducer of the IFN-beta promoter, whereas SV5 was a poor inducer. The ability of SeV and SV5 to inhibit the activation of IFN-responsive genes in human cells was confirmed by RNase protection experiments. The importance of these results in terms of paramyxovirus pathogenesis is discussed.
...
PMID:Sendai virus and simian virus 5 block activation of interferon-responsive genes: importance for virus pathogenesis. 1007 64

The low precursor frequency of Ag-reactive CD4+ T cells has been a barrier to the study of CD4+ T cell responses to conventional Ags as well as CD4+ T cell responses to autoantigens recognized during the course of an autoimmune disease. We have recently reported that all "conventional Ag" reactive CD4+ T cells are contained within the subpopulation expressing high levels of the CD4 molecule, termed CD4high. We have identified a CD4high population in the islets of Langerhans of prediabetic nonobese diabetic (NOD) mice that is extremely potent in transferring disease. As few as 500 CD4high islet-infiltrating CD4+ T cells transferred insulin-dependent diabetes mellitus to CD8 reconstituted NOD-SCID mice within 30 days of transfer. In contrast, CD4high T cells isolated from either NOD spleen or salivary glands did not transfer insulin-dependent diabetes mellitus into similar CD8-reconstituted NOD-SCID recipients. These data indicate that the precursor frequency of NOD islet-reactive, pathogenic CD4+ T cells is much higher in the prediabetic NOD pancreas than in these other organs. The islet-infiltrating CD4high T cells displayed selected memory markers, by cell surface analysis, and displayed a Th 1 phenotype by RNase protection assay, but had a marked decrease in IL-4 mRNA determined by quantitative real time PCR when compared with the less pathogenic CD4normal islet-infiltrating T cells. Use of the CD4high marker to select Ag activated T cells represents a tool to isolate and study pathogenic CD4+ T cells from autoimmune lesions in which the Ag has not been previously defined.
...
PMID:Isolation of self antigen-reactive cells from inflamed islets of nonobese diabetic mice using CD4high expression as a marker. 1055 2

The RNase-resistant and membrane-permeable antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNA) against RIalpha subunit of protein kinase A (RIalpha/PKA) has been used to inhibit the growth of human breast cancer MDA-MB-231 cells in vitro and in vivo. This antisense poly-DNP-RNA, with oligonucleotide sequence GGGCGUGCCUCCUCACUGGC, was found to be an effective concentration-dependent inhibitor of MDA-MB-231 cell line, whereas the control poly-DNP-RNAs with either random or sense sequence were found completely inactive. In situ hybridization studies showed that this antisense inhibitor can permeate spontaneously into MDA-MB-231 cells and distribute itself throughout the cytoplasm. Intraperitoneal administration of this antisense RIalpha poly-DNP-RNA to SCID mice with transplanted MDA-MB-231 cells was found to inhibit the growth of the xenografts in a concentration-dependent way, prevent metastasis, and drastically reduce mortality.
...
PMID:Growth inhibition and antimetastatic effect of antisense poly-DNP-RNA on human breast cancer cells. 1090 62

Eosinophils have been shown to increase in tissues during many fibrotic conditions and consequently have been suggested to contribute to the development of fibrosis. This study tested the hypothesis that eosinophils are essential in the development of lung fibrosis in mice in response to bleomycin (BLM). Anti-IL-5 antibody was administered intraperitoneally into mice 2 h prior to endotracheal BLM inoculation and thereafter, every other day. Lung eosinophilia was evaluated by measurement of eosinophil peroxidase activity and confirmed by eosinophil counts in histologic sections. Lung fibrosis was evaluated by hydroxyproline content and confirmed by collagen staining in histological sections. Results demonstrated that BLM induced pronounced lung eosinophilia, which was maximal 7 days after BLM treatment and remained elevated through day 14, in C57B1/6 SCID mice and CBA/J mice. In contrast, eosinophilia was a minor component in the lungs of wildtype C57B1/6 mice after BLM treatment, although lung fibrosis developed similarly in all three strains of mice. Treatment with anti-IL-5 completely abrogated eosinophilia but failed to block pulmonary fibrosis induced by BLM in all mouse strains, including C57B1/6 SCID, wildtype C57B1/6 mice, and CBA/J mice. Analysis of cytokine mRNA by RNase-protection assay in C57B1/6 SCID mice indicated that BLM treatment caused enhanced expression of the cytokines, TNF-alpha, and IL-6 at days 3, 7, and 14 post-BLM inoculation, regardless of whether eosinophils were depleted by anti-IL-5. Finally, the importance of eosinophils in lung fibrosis was examined in IL-5 gene knockout mice (IL-5tm1Kopf). BLM treatment induced significant lung fibrosis in IL-5 knockout mice in the absence of eosinophilia. These findings indicate that eosinophils are not an absolute requirement for BLM-induced pulmonary fibrosis in the mouse.
...
PMID:Bleomycin-induced pulmonary fibrosis is independent of eosinophils. 1103 73

A variety of autoantibodies is responsible for the tissue injury in autoimmune diseases. We have demonstrated that the human anti-DNA Ab O-81, of which Ids are commonly detected in renal glomeruli of active lupus nephritis, uses the V3-7 gene. We tried to develop a new therapy for lupus nephritis by using chemically modified ribozymes to specifically inhibit the expression of the mRNA of Ig V gene. The transfection of hammerhead ribozyme or the addition of chemically modified ribozyme against the flanking region of V3-7 caused a potent and selective inhibition of anti-DNA production in V3-7-using B cell clones, but not in irrelevant V gene-using clones in vitro. Chemically modified ribozyme was long-acting and resistant to RNase, and nonspecific cytotoxicity of the ribozyme was negligible. To know the efficacy of the ribozyme in vivo, we used a model of immune complex nephritis in SCID mice in which 5 x 10(6) PBLs from patients with active lupus nephritis (lupus PBL) were transferred twice. The injection of lupus PBL in combination with chemically modified ribozyme to increase resistance to RNase significantly reduced anti-DNA Ab levels in blood and decreased levels of urinary protein in the immune deposit models. Immunofluorescence study also revealed a marked decrease in IgG deposits at renal glomeruli in the ribozyme-treated group. These results indicate an efficacy of chemically modified ribozyme therapy for autoantibody-mediated immune diseases.
...
PMID:Chemically modified ribozyme to V gene inhibits anti-DNA production and the formation of immune deposits caused by lupus lymphocytes. 1106 51


1 2 3 Next >>

---