Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.27.4 (ribonuclease)
 6,621 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Thyroid hormones influence both bone formation and bone resorption. Clinical data and animal studies provide evidence of skeletal site heterogeneity (hip vs. spine) of bone responses to thyroid hormones. In vitro studies also demonstrate direct effects of thyroid hormones on cells of the osteoblast lineage. Transcriptional regulation by thyroid hormone is mediated by ligand-dependent transcription factors called thyroid hormone receptors (TRs). Two genes, c-ErbAalpha and c-ErbAbeta, generate at least four TR isoforms in the rat: TRalpha(1), c-erbAalpha(2), TRbeta(1), and TRbeta(2). Although functional TRs have been identified in cells of the osteoblast lineage, it is still not known if TR isoform expression in bone differs depending upon which skeletal site is examined. We have used ribonuclease protection assay and Northern blot analysis to simultaneously examine the expression of TR isoform mRNAs in adult rat femoral and vertebral bone. TRalpha(1), c-erbAalpha(2), and TRbeta(1) are expressed in both femur and vertebra whole bone. Bone marrow cells from both skeletal sites were also cultured under conditions whereby the osteoprogenitors differentiated into osteoblasts and formed a mineralized extracellular matrix. TRalpha(1), c-erbAalpha(2), and TRbeta(1) mRNAs are each expressed in both femoral and vertebral osteoblast cultures. The presence of TRalpha(1), c-erbAalpha(2), and beta(1) proteins was confirmed by Western analysis of nuclear protein extracts from femoral and vertebral cell cultures. These results indicate that the three predominant TR isoforms are highly expressed in bone and osteoblasts from femurs and vertebrae. Whether there are distinct mechanisms of thyroid hormone action mediated by TRalpha(1), c-erbAalpha(2), and TRbeta(1) at these separate skeletal sites remain to be shown.
 ...
PMID:Expression of multiple thyroid hormone receptor isoforms in rat femoral and vertebral bone and in bone marrow osteogenic cultures. 1044 Sep 37

Hypothyroidism has devastating consequences on brain development. While the mechanisms that mediate these effects are not known, several lines of evidence suggest that a reduction in insulin-like growth factor-I (IGF-I) expression and/or action has a role. To assess whether reduced IGF-I expression and/or actions mediates the brain pathology of congenital hypothyroidism, we induced hypothyroidism by treating pregnant mice and lactating dams with 0. 1% propylthiouracil (PTU) in drinking water. Control and PTU-treated pups were sacrificed on postnatal day (P) 7, 10 and 14, and IGF-I mRNA expression was assessed in the cerebral cortex and cerebellum by ribonuclease protection assay. To control for mRNA loading, the signal of IGF-I protected bands was normalized to those for cyclophillin. IGF-I mRNA expression in hypothyroid animals was decreased significantly in cortex at P10 and P14 (42 and 60%, respectively). In the cerebellum, IGF-I mRNA expression was down-regulated at all ages studied, but the decrease was only statistically significant at P7 (31% decreased). We conclude that hypothyroidism alters IGF-I expression in the developing brain. Furthermore, we speculate that IGF-I plays a role in mediating some thyroid hormone actions during brain development.
 ...
PMID:Effects of hypothyroidism on insulin-like growth factor-I expression during brain development in mice. 1102 43

The effects of all-trans-retinoic acid (RA), 9-cis-retinoic acid (9cRA), and thyroid hormone (T3) on GH-releasing hormone receptor (GHRH-R) messenger RNA (mRNA) expression were studied using ribonuclease protection assay in the fetal rat pituitary gland and in MtT/S cells, a clonal GH cell line derived from an estrogen-induced somatotropic tumor in the rat. Although RA (1 microM), 9cRA (1 microM), or T3 (1 nM) alone showed little effect on GHRH-R mRNA expression in the MtT/S cells, each of these substances was found to act synergistically with dexamethasone (DEX; 500 nM) to increase GHRH-R mRNA expression. The effects of RAs and T3 were dose dependent, with maximum effects observed at 1 microM and 1 nM, respectively. The maximum effect of RAs or T3 was not further augmented by the addition of T3 or RAs, respectively. No apparent differences were observed in this study between the actions of RA and 9cRA. The Northern analyses showed that MtT/S cells express retinoic acid receptor alpha2 mRNA and thyroid hormone receptor beta2 mRNA, and DEX did not affect the levels of these mRNAs. This suggests that the role of DEX in enabling RAs or T3 to up-regulate GHRH-R mRNA levels is not an induction of the expression of each specific receptor for RAs and T3. The similar enhancement of DEX induction of GHRH-R mRNA by RAs or T3 was also observed in the fetal rat pituitary gland in culture, suggesting that RA and/or T3 is involved in the mechanisms responsible for the developmentally regulated expression of GHRH-R mRNA.
 ...
PMID:Retinoic acids and thyroid hormone act synergistically with dexamethasone to increase growth hormone-releasing hormone receptor messenger ribonucleic acid expression. 1110 47

Thyroid hormones has its main role in controlling metabolism, but it can also modulate extracellular fluid Volume (ECFV) through its action on the expression and activity of Na(+) transporters. Otherwise, chloride is the main anion in the ECFV and the influence of thyroid hormones in the regulation of chloride transporters is not yet understood. In this work, we studied the effect of thyroid hormones in the expression of ClC-2, a cell Volume-, pH- and voltage-sensitive Cl(-) channel, in rat kidney. To analyze the modulation of ClC-2 gene expression by thyroid hormones, we used hypothyroid (Hypo) rats with or without thyroxine (T(4)) replacement and hyperthyroid (Hyper) rats as our experimental models. Total RNA was isolated and the expression of ClC-2 mRNA was evaluated by a ribonuclease protection assay, and/or semi-quantitative RT-PCR. Renal ClC-2 expression decreased in Hypo rats and increased in Hyper rats. In addition, semi-quantitative RT-PCR of different nephron segments showed that these changes were due exclusively to the modulation of ClC-2 mRNA expression by thyroid hormone in convoluted and straight proximal tubules. To investigate whether thyroid hormones action was direct or indirect, renal proximal tubule primary culture cells were prepared and subjected to different T(4) concentrations. ClC-2 mRNA expression was increased by T(4) in a dose-dependent fashion, as analyzed by RT-PCR. Western blotting demonstrated that ClC-2 protein expression followed the same profile of mRNA expression.
 ...
PMID:Thyroid hormone modulates ClC-2 chloride channel gene expression in rat renal proximal tubules. 1296 41

Resistance to hormonal therapy is often a problem in the treatment of breast cancer patients. It has been suggested that resistance could be explained by altered nuclear hormone receptor or coregulator levels or inappropriately increased agonist activity of selective estrogen receptor modulator (SERM). To test these hypotheses, we have established novel MCF-7 cell line-derived in vitro models of anti-estrogen- and progestin-resistant and estrogen-independent breast cancer by long-term culture in the presence of toremifene and medroxyprogesterone acetate (MPA) and in the absence of estradiol, respectively. Using cell growth and multiprobe ribonuclease protection assays, the expression of 5 nuclear hormone receptors and 9 coregulators as well as the alterations in the cell proliferation and target gene transcription in response to hormonal treatments were studied. Progesterone receptor (PR) expression was decreased and silencing mediator for retinoid acid and thyroid hormone receptors (SMRT) and amplified in breast cancer-1 (AIB1) expression increased in anti-estrogen-resistant cells. Estrogen caused PR and ERbeta upregulation in all cell lines, but we did not observe increased agonist activity of anti-estrogen measured by regulation of these estrogen target genes. Basal ERalpha levels and estrogenic growth response were decreased and p300/CBP-associated factor (pCAF) and AIB1 upregulated by estrogen in progestin-resistant cells, but coregulator levels were unchanged. Estrogen-independent cells were still estrogen-responsive and PR, nuclear receptor corepressor (N-CoR) and SMRT expression was increased whereas steroid receptor coactivator-1 (SRC-1a) and CBP-related protein p300 (p300) expression decreased. Their growth was inhibited by toremifene, but estradiol was able to abrogate this effect, which might have interesting clinical implications concerning the use of postmenopausal hormone replacement therapy.
 ...
PMID:Steroid hormone receptors and coregulators in endocrine-resistant and estrogen-independent breast cancer cells. 1615 93

Hyperthyroidism is associated with low exercise tolerance despite high cardiac output and sometimes with the development of heart failure. L-type calcium channels may play a role in the mechanism, but this has not been fully understood. We examined the effects of thyroid hormone on gene expression and function of L-type calcium channels in rat ventricles by the ribonuclease protection assay and whole-cell patch-clamp technique, respectively. The effects of bisoprolol, beta-blocking agent, on the regulation of calcium channel by thyroid hormone was also studied. In hyperthyroid animals, the mRNA of the calcium channel alpha1c subunit was reduced on day 4, compared with that in euthyroid animals, and remained low on day 8. Bisoprolol did not affect the thyroid hormone mediated decrease in alpha1c subunit mRNA. While L-type calcium current was greater in hyperthyroid than euthyroid myocytes on day 4, it was smaller on day 8. In addition, the isoproterenol-induced increase in calcium current in euthyroid rats was attenuated in hyperthyroid rats. Acetylcholine decreased calcium current in hyperthyroid myocytes, but not in euthyroid myocytes. In conclusion, L-type calcium current was increased by thyroid hormone in rat ventricular myocytes by the activation of the adenylate cyclase cascade, despite a decreased calcium channel gene expression. These genomic and non-genomic modifications may play an important role in the association of high cardiac output with low exercise tolerance, and in the development of heart failure in hyperthyroidism.
 ...
PMID:Genomic and non-genomic regulation of L-type calcium channels in rat ventricle by thyroid hormone. 1623 92

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.
 ...
PMID:Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone. 1679 15


<< Previous 1 2