Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.27.4 (ribonuclease)
6,621 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Point mutations of the donor splice site of intron 3 of the human GH-1 gene cause autosomal dominant inherited isolated growth hormone deficiency (IGHD II). The mechanism by which a defect in one GH-1 allele results in GH deficiency is obscure. Previously reported reverse transcription-nested PCR data suggested an overexpression of the mutant GH-1 allele. We employed alternative methods to determine the relative expression of mutant (C for G at +1 of intron 3) and normal GH-1 allele. The use of a second round PCR primer bridging exons 2 and 3 and specific for normal GH-1 messenger ribonucleic acid (mRNA) indicated equal quantities in mutant and control cells. Large scale messenger RNA extraction from Epstein-Barr virus-transformed lymphoblasts permitted assay by ribonuclease protection. In normal pituitary, there were three GH-1 mRNA species. The variant lacking exon 3 comprised 5% of the total GH-1 mRNA. The proband's lymphoblasts contained equal amounts of mRNA with and without exon 3. Only normal GH-1 mRNA was detected in controls. Secreted GH, measured by enzyme-linked immunosorbent assay was present in equal concentrations in media from normal and mutant cells. Thus, GH-1 mRNA lacking exon 3 was expressed in proportion to the dosage of the mutant gene, and dominant effects on GH secretion were not observed in lymphoblasts. These findings are compatible with a dominant negative mechanism involving interaction between normal and mutant proteins in secretory vesicles of somatotropes.
...
PMID:Mechanisms responsible for dominant expression of human growth hormone gene mutations. 892 59

Fetal growth is increased when pregnant gilts are treated with recombinant porcine somatotropin. The mechanism for increased fetal growth was examined by measuring the expression of IGF-I and -II and IGF-binding protein-2 (IGFBP-2) mRNA in liver and reproductive tissues of somatotropin- and saline-treated pregnant gilts. Twenty-four pregnant gilts received daily injections of either saline (control; n=12) or 5 mg recombinant porcine somatotropin (n=12) from day 30 to day 43 of gestation. Gilts were slaughtered on day 44 of gestation and liver, ovary, placenta, placental uterus (uterus with adjacent placental tissue) and non-placental uterus (region of the necrotic tip) were collected. The mRNAs for somatotropin receptor, IGFs -I and -II, IGFBP-2 and pregnancy-associated glycoprotein (a marker of trophoblast tissue) were analyzed by Northern blotting or ribonuclease protection assay. Gilts treated with somatotropin had heavier fetuses and placentas. The concentration of mRNA for the components of the IGF system was tissue-dependent. The uterine IGF-I mRNA concentration was greater in non-placental than in placental uterus. The greatest IGF-II mRNA concentration was observed in placenta, and adjacent uterine tissue expressed IGFBP-2 mRNA intensely. In non-placental uterus, IGFBP-2 mRNA was nearly undetectable. Somatotropin-dependent regulation of IGF-I was only observed in liver, where the greatest somatotropin receptor mRNA concentration was found. In the pregnant uterus, somatotropin failed to change the concentration of IGF or IGFBP-2 mRNA. Pregnancy-associated glycoprotein mRNA concentration was decreased by somatotropin. In summary, increased fetal growth in somatotropin-treated pregnant pigs was not associated with changes in IGF or IGFBP-2 mRNA concentration in reproductive tissues. Other mechanisms, therefore, lead to enhanced fetal growth in somatotropin-treated pregnant pigs.
...
PMID:Insulin-like growth factor (IGF)-I, IGF-II, IGF-binding protein-2 and pregnancy-associated glycoprotein mRNA in pigs with somatotropin-enhanced fetal growth. 983 61

The effect of treatment with thyroxine (T(4)) on the hepatic deiodinase (5'D-I) activity and triiodothyronine (T(3)) content and on insulin-like growth factor-I (IGF-I) secretion and mRNA hepatic expression were studied in neonatal and adult diabetic (D) rats and compared with 4 thyroidectomized (Tx) groups: neonatal and adult Tx rats treated or not with T(4). Serum T(3) and T(4) decreased by 92% in both Tx populations and by 80% to 70% in D adults according to the severity of diabetes: -70 mg/kg body weight (BW) (D(70)) or 50 mg/kg BW (D(50)) of streptozotocin (STZ) injected, whereas only a 30% to 33% decrease was found in D neonates. A similar decrease of liver 5'D-I activity and T(3) concentrations was found in neonatal and adult Tx rats, whereas a significant reduction in those parameters was observed only in adult diabetics, either D(70) or D(50), but not in D neonates. Serum levels and liver mRNA expression of IGF-I determined by ribonuclease protection assay, plasma and pituitary growth hormone (GH), plasma insulin, and glycemia were also measured in both D populations. A decrease in circulating IGF-I, previously reported for Tx adult rats, was also found in both D populations. T(4) treatment recovered IGF-I and liver T(3) in both Tx groups and D neonates, but not in D adults. These results show an age-dependent adaptation of the liver thyroid economy in diabetes, as hepatic 5'D-I does not respond to diabetes in neonates and IGF-I is insensitive to T(4) treatment in adult diabetics and suggest a positive correlation between hepatic T(3) content and IGF-I expression in conditions of diabetes and Tx.
...
PMID:Age-dependent adaptation of the liver thyroid status and recovery of serum levels and hepatic insulin-like growth factor-I expression in neonatal and adult diabetic rats. 1450 16

Growth hormone (GH) regulates the expression of many genes in the liver, and for some genes this regulation may be mediated through liver-enriched transcription factors (LETFs). As part of the long-term goal to investigate the role of LETFs in GH regulation of gene expression in the liver, in this study we determined the effect of GH administration on the expression of 10 LETFs, including hepatocyte nuclear factor (HNF)-1alpha, HNF-1beta, HNF-3alpha, HNF-3beta, HNF-3gamma, HNF-4alpha, HNF-6, CCAAT/enhancer-binding protein (C/EBP) alpha, C/EBPbeta, and albumin D-element binding protein (DBP) in the bovine liver. Eighteen non-lactating and non-pregnant Angus cows were assigned randomly to three groups (n=6 per group) and each cow received a single intramuscular injection of 500 mg slow-release recombinant bovine GH. Liver biopsy samples were taken from group 1 cows 6 h after GH administration, from group 2 cows 24 h after GH administration, and from group 3 cows 1 week after GH administration. Liver biopsies were also collected from group 3 cows 1 day before GH administration, serving as pre-GH controls. The LETF mRNAs in these liver samples were quantified using ribonuclease protection assays with probes generated from bovine LETF cDNAs cloned by standard reverse transcription-polymerase chain reaction. The levels of HNF-3gamma and HNF-6 mRNAs were higher (P< 0.05) in the cows 24 h and 1 week after GH administration than in the untreated cows or the cows 6 h after GH administration. The levels of HNF-4alpha mRNA were higher (P< 0.05) in the cows 1 week after GH administration than in the other three groups of cows. The levels of C/EBPalpha mRNA were higher (P< 0.05) in the cows 24 h after GH administration than in the untreated cows or the cows 6 h after GH administration. The levels of HNF-3alpha mRNA were higher (P< 0.05) in the cows 6 h after GH administration but were lower (P< 0.05) in the cows 24 h or 1 week after GH administration compared with those in the untreated cows. The levels of DBP mRNA were higher (P< 0.05) in the cows 6 h after GH administration but were lower (P< 0.05) in the cows 24 h after GH administration compared with those in the untreated cows. The levels of HNF-1alpha, HNF-3alpha, and C/EBPbeta mRNAs were not different (P>0.05) between groups. The expression of HNF-1beta mRNA was not detectable. Thus, the expression of six LETFs including HNF-3gamma , HNF-3beta, HNF-4alpha, HNF-6, C/EBPalpha, and DBP mRNAs in the bovine liver is regulated by GH, and these six LETFs may play a role in mediating GH regulation of gene expression in the liver. Among the 10 LETFs, the response of HNF-3gamma to GH is most significant. Cloning and sequencing the promoter region of this gene revealed multiple putative binding elements for signal transducers and activators of transcription 5 (STAT5), suggesting that GH regulation of HNF-3gamma expression in the liver may be mediated through direct binding of STAT5 to the HNF-3gamma promoter.
...
PMID:Growth hormone regulates the expression of hepatocyte nuclear factor-3 gamma and other liver-enriched transcription factors in the bovine liver. 1564 87

Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. Growth hormone (GH) action has its effect on linear growth and on bone remodeling and homeostasis. Recently, GH has been used to improve severe short stature caused by not only GH deficiency (GHD) but also some skeletal dysplasias including achondroplasia. To improve severe short stature, we treated the patient with 0.175 mg kg-1 week-1 of GH for 7 years. His height was improved from -4.2 SD to -3.0 SD by 1 year of GH treatment. Following treatment had given positive effects continuously on his height to -2.6 SD by 3.1 years GH medication. Then, when he was 6 years old, surgical lengthening was performed and his height reached to -2.0 SD. After the surgery, we continued GH treatment. Additional GH treatment of 3.6 more years had kept his height to -2.0 SD. However, when he was 8 years old, because there was an interruption of GH treatment, the velocity of his height was obviously decreased comparing before and during the interruption, which was calculated 3.4 and 2.2 cm/year, respectively, and the SD score was decreased to -2.1 SD. This result of total 7 years of GH treatment suggested that GH treatment significantly improved his disturbed bone growth and had also positive efficacy to keep growth rate. This result implies the connection between GH signal and RMRP gene. Additionally, GH may be considered to be an efficient treatment for CHH.
...
PMID:An effective case of growth hormone treatment on cartilage-hair hypoplasia. 1578 Sep 58