Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:3.1.27.1 (RNase)
16,360 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The presence of a nuclear DNA polymerase in mouse sperm from adult testes has been confirmed and the properties of this enzyme further investigated. This activity was shown to be greatly enhanced by treating the spermatozoa with methanol or ethanol before incubation in the reaction medium or by their addition in small amounts to this medium. It was protected against degradation by nuclear proteases by adding soybean trypsin inhibitor and was stimulated by ATP. It was found to be Mg2+ dependent (optimum concentration: 7.5 mM), DNA dependent, and all four deoxynucleoside triphosphates were needed for optimal reaction. The radioactive acid-precipitable product of polymerization was not eliminated by organic solvents, nor by pronase, ribonuclease or by nuclease S1; however, it was converted to a large extent to acid-soluble products by pancreatic deoxyribonuclease. Since it was only partially solubilized by Triton X-100, it therefore did not appear to be preferentially associated with the nuclear membranes. The activity recovered after incubation depended also on the pH (optimum at pH 8.3) and did not work well in a medium for DNA polymerase alpha. The temperature for maximum incorporation of nucleotides was found to be 32 degrees C and, under our conditions, the reaction was linear for 30 min. The DNA polymerase activity was inhibited by low and high concentrations of KCl. It was not lowered by N-ethylmaleimide or p-hydroxymercuribenzoate; urea slightly stimulated the reaction and this stimulation was reversed by subsequent treatment with N-ethylmaleimide. Actinomycin D (40 mug/ml), ethidium bromide (25--50 muM), netropsin (5--50 mug/ml), and spermidine (0.5--2.5 mM) lowered the polymerization of DNA precursors. The nuclear enzyme could shift from the endogenous template to activated exogenous calf thymus DNA, the resulting nuclear radioactivity being reduced. The endogenous DNP template ability was not increased by deoxyribonuclease activation according to the method of Aposhian and Kornberg (J. Biol. Chem. (1962) 237, 519--525) suggesting that the amount of DNA polymerase associated with chromatin was probably limiting the reaction. The DNA polymerase activity detected in mouse sperm nuclei has numerous properties of low molecular weight DNA polymerases (DNA polymerase beta) reported in several eukaryotic organisms.
...
PMID:Further characterization of a DNA polymerase activity in mouse sperm nuclei. 1 3

Fidelity of preribosomal RNA transcription in vitro was studied after selective deproteinization of nucleoli using either sequential salt extraction or sodium deoxycholate treatment. Homochromatography fingerprinting and identification of marker oligonucleotides from a T1 ribonuclease digest of the transcripts were used to evaluate the RNA products. These studies indicated that: (1) nucleoli retained their endogenous RNA polymerase I activity and the specificity of transcription up to 0.6 M NaCl extraction; (2) exogenous RNA polymerase I transcribed nucleolar chromatin only after 1.0 M NaCl extraction and the transcription pattern, like that of totally deproteinized DNA, was completely random; (3) extraction of nucleoli with deoxycholate resulted in a DNP complex in which the endogenous RNA polymerase I transcribed pre-rRNA specifically; however, it also initiated random transcription, producing a "mixed" fingerprint pattern on the homochromatogram. The random transcription was selectively inhibited either by deoxycholate or rifampicin AF/013. These studies indicate that the selectivity of pre-rRNA transcription is due both to the endogenous RNA polymerase I molecules that were involved in transcription in vivo and are tightly bound to the template and to factors in intact nucleoli which prevent random transcription by the released RNA polymerase I molecules.
...
PMID:Studies on the specificity of preribosomal RNA transcription in nucleoli after selective deproteinization. 11 95

A single injection of the carcinogen 3'-methyl-4-dimethylaminoazobenzene (3'MDAB) or its non-carcinogen analogue 2-methyl-4-dimethylaminoazobenzene (2-MDAB) 300 mg/1000 g body weight led to the increase in the RNA-synthetic capacity of liver cell nuclei in vitro. No differences were found in the ribonuclease activity; in the template activity of DNA and DNP with E. coli RNA-polymerase, and in the melting temperature of DNA and DNP in the presence of 3'MDAB and in the control. The apparent value or Km of the RNA synthesis reaction are equal both for the control animals and those treated with 3'MDAB, but Vmax is lower in the control. It is suggested that the increase of RNA synthetic capacity of the nuclei of rat liver cells, found in vitro at early stages of the carcinogen (3'MDAB) action, should be regarded as the manifestation of its toxic effect and is proposed to be due to the increase of the concentration of RNA-polymerase which is capable to catalyse the RNA synthesis in nuclei.
...
PMID:[Changes in RNA synthesis at early stages of aminoazocancerogenesis]. 81 58

BALB/c mice with the plasmacytoma MOPC 104E producing monoclonal IgM-lambda with antibody activity to alpha-1,3 dextran were found to have B lymphocytes with surface immunoglobulins with the immunochemical characteristics of 104E IgM capable of binding alpha-1,3 dextran. RNA extracted from this plasmacytoma induced the synthesis of such surface immunoglobulins on normal B lymphocytes in vitro and in vivo. Injection of 200 mug of MOPC 104E RNA into normal mice 72 hr prior to the administration of the antigen kept the immune response to dextran-S intact, but suppressed that to other antigens, such as DNP-Ficoll and LPS, T cell-independent antigens, and SRBC and BSA which are T cell-dependent. The effect of the RNA was abolished by RNase but not by pronase and DNase. RNA extracted from LPC-1 tumour (gamma2a-k without known antibody activity) significantly suppressed the immune response to dextran-S and to other antigens in normal mice. Thus, opposite effects of MOPC 104E RNA on the response to specific and non-specific antigens strengthen the hypothesis that the immune deficiency in plasmacytoma bearing mice is due to the conversion of normal surface immunoglobulin of a population of B lymphocytes to the idiotype of the respective myeloma globulin.
...
PMID:Surface immunoglobulins of lymphocytes in plasmacytoma. V. The effect of RNA-rich extract from mouse plasmacytoma MOPC 104E on the immune response. 127 83

This study presents 8 dogs of German Shepherd breed (6 males, 2 females, 2-5 years of age at onset of the disease) with a lupus like syndrome characterized by febrile polyarthritis, wasting, nephropathy, cutaneous lesions and high positive titres of ANA (antinuclear antibodies) of speckled type. The serum autoantibodies were further characterized by double immunodiffusion against ENA (extractable nuclear antigen), ELISA for Histone antibodies (Histon fraction H-24A and H-3S), indirect IF on rat-liver sections, non treated and RNase/DNase digested sections for DNP/RNP antibodies, and smears of a hemoflagellate C. luciliae for antibodies vs doubbel strained DNA, (dsDNA). Thus, the high ANA titres in these dogs represent varying types of autoantibodies against nucleoproteins of both DNA and RNA nature, associated histone antigens and non-histone antibodies (RNA and Sm) as well. Rheumatoid Factor titres in serum from these dogs were low or negative. Immunoglobulin deposits at dermo-epidermal junctions were demonstrated in some of the dogs with hyperkeratotic skin lesions. High concentration of serum-IgG was a constant finding in combination with anemia and in most cases leukopenia probably related to the chronic inflammatory process in these animals. Autoimmune hemolytic anemia (AIHA) or thrombocytopenia was not detected in these dogs.
...
PMID:Serum auto antibodies and clinical/pathological features in German shepherd dogs with a lupuslike syndrome. 195 Aug 49

Murine T cell replacing factor (TRF) was purified from a cellfree supernatant of a T cell hybridoma (B151K12) that constitutively produces TRF. Two assay systems for TRF activity were employed: 1) induction of anti-DNP IgG PFC responses in cultures of splenic B cells from DNP-KLH-primed BALB/c mice, and 2) induction of IgM PFC in chronic B cell leukemic cells (BCL1). The purification scheme consisted of ammonium sulfate precipitation, DEAE-cellulose chromatography, Blue-Sepharose chromatography, hydroxylapatite chromatography, gel permeation with fast protein liquid chromatography (FPLC), and disc polyacrylamide gel electrophoresis. Overall, TRF was purified approximately 34,000-fold with a maximum 3.8% recovery of activity, and the specific activity of the purified TRF was approximately 9.6 X 10(4) U/mg. The TRF that is active in these systems is distinct from the other lymphokines such as IL 1, IL 2, BCGFI (now known as BSFp1), and gamma-interferon. The TRF is extremely hydrophobic, with an apparent m.w. of 50,000 to 60,000 on gel permeation chromatography and 18,000 on SDS-PAGE under reducing conditions. Highly purified B151-TRF abrogated the activity by treatment with trypsin but not with RNase. Moreover, it bound to lima bean agglutinin-Sepharose specific for N-acetylgalactosamine residues, indicating that B151-TRF is a glycosylated glycoprotein containing N-acetylgalactosamine residues. The role of N-acetylgalactosamine residues on TRF activity was additionally substantiated by the fact that the addition of appropriate amounts of N-acetylgalactosamine in the assay systems for TRF preferentially induced a profound suppression for TRF-mediated PFC responses.
...
PMID:Purification and physicochemical characterization of murine T cell replacing factor (TRF). 387 Nov 9

Poly[2'-O-(2,4-dinitrophenyl)]poly(A)[DNP-poly(A)] has been found to be a potent inhibitor in solution for RNases A, B, S, T1, T2 and H as well as phosphodiesterases I and II. Kinetic measurements with RNase B and RNase T1 showed DNP-poly(A) to be a reversible competitive inhibitor with K1 equal to 1.03 and 1.05 microM, respectively. Data on the quenching of fluorescence of RNase T1 by DNP-poly(A) indicate the existence of more than one RNase-binding site in each DNP-poly(A) molecule. By attaching each DNP-poly(A) molecule at one end covalently to oxirane acrylic beads, an affinity column was prepared for selective removal of RNases from aqueous solutions by simple filtration. It was found that a 1000-fold reduction in RNase concentration can be obtained by passing either 7.0 microM or 7.0 nM RNase A solution through a 5-cm-long column. The column can be saturated by passing through a concentrated RNase solution and subsequently regenerated by washing with salt solution. The regenerated column can be used repeatedly with no significant decrease in RNase-binding affinity and capacity. By titration of the derivatized beads with RNase, the first dissociation constant (Kd) and binding capacity for the bound enzyme can be determined. The (Kd) was found to be 0.66 microM for RNase B and 0.48 microM for RNase T1; the corresponding binding capacities were found to be 21.0 x (10)-8 and 9.6 x (10)-8 mol/g, respectively.
...
PMID:Selective removal of ribonucleases from solution with covalently anchored macromolecular inhibitor. 877 29

Two membrane-permeable and RNase-resistant antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNAs) have been synthesized as inhibitors of human breast cancer, with nucleotide sequences complementary to the genes of RIalpha subunit of protein kinase A (RIalpha/PKA) and erbB-2, respectively. Both compounds inhibit the proliferation of SK-Br-3 breast cancer cells in culture above the concentration of 10 microg/ml, but have no effect on nontumorigenic MCF-10A breast cells. These antisense inhibitors also block the cell colony formation in methylcellulose medium, whereas the control poly-DNP-RNA with either random or sense sequence has no effect. RT-PCR data show that the antisense inhibition decreases the concentration of the mRNA. TdT-mediated dUTP nick-end labeling (TUNEL) fluorescence assay indicates that the targeted antisense inhibition by poly-DNP-RNAs leads to apoptosis of SK-Br-3 cells but does not affect nontumorigenic MCF-10A cells. The control poly-DNP-RNAs with random or sense nucleotide sequence are completely inactive.
...
PMID:Specific inhibition of breast cancer cells by antisense poly-DNP-oligoribonucleotides and targeted apoptosis. 1010 Jul 55

The RNase-resistant and membrane-permeable antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNA) against RIalpha subunit of protein kinase A (RIalpha/PKA) has been used to inhibit the growth of human breast cancer MDA-MB-231 cells in vitro and in vivo. This antisense poly-DNP-RNA, with oligonucleotide sequence GGGCGUGCCUCCUCACUGGC, was found to be an effective concentration-dependent inhibitor of MDA-MB-231 cell line, whereas the control poly-DNP-RNAs with either random or sense sequence were found completely inactive. In situ hybridization studies showed that this antisense inhibitor can permeate spontaneously into MDA-MB-231 cells and distribute itself throughout the cytoplasm. Intraperitoneal administration of this antisense RIalpha poly-DNP-RNA to SCID mice with transplanted MDA-MB-231 cells was found to inhibit the growth of the xenografts in a concentration-dependent way, prevent metastasis, and drastically reduce mortality.
...
PMID:Growth inhibition and antimetastatic effect of antisense poly-DNP-RNA on human breast cancer cells. 1090 62

The antisense inhibitor poly-2'-O-(2,4-dinitrophenyl)-5'-GGCUGCGUGCCUCCUCACUGG (antisense poly-DNP RNA-21) has been synthesized by in vitro transcription followed by chemical derivatization. Its base sequence is complementary to that of nucleotides 110-130 in the mRNA of the regulatory RIalpha subunit of PKA (RIalpha/PKA), which is overexpressed in MCF-7 breast cancer cells and A549 lung cancer cells. The bioavailable and RNase-resistant antisense poly-DNP RNA-21 was found to inhibit cell growth with 50% inhibitory concentration (IC50) values of 0.05 nM in MCF-7 cells and 4 nM in A549 cells. The control 21-nt RNAs with the same poly-DNP oligonucleotide (ODN) platform but with scrambled, sense, or mismatched base sequence are inactive. Treatment of MCF-7 cells with antisense poly-DNP RNA-21 abolishes both the steady-state concentration of RIalpha mRNA and the synthesis of RIalpha protein. At sufficiently high concentration, antisense poly-DNP RNA-21 selectively kills the targeted cancer cells by inducing apoptosis. The observed sequence specificity and extremely low IC50 values of antisense poly-DNP RNA-21 suggest that it is a promising candidate for in vivo testing as an effective anticancer agent.
...
PMID:A high-efficacy antisense RIalpha poly-DNP 21-nt RNA. 1269 37


1 2 Next >>

---