Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.27.1 (RNase)
16,360 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The rat alpha-thyroid hormone receptor gene encodes through alternative splicing at least three protein isoforms with different functions, and three mRNA species (2.6, 5.4, 6.8 kilobase (kb) in size) are detected using alpha gene-specific probes (Mitsuhashi, T., Tennyson, G. E., Nikodem, V. M. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 5804-5808). In the present study, the identities of these mRNAs were analyzed by Northern analysis, and it was demonstrated that in rat brain the receptor protein is encoded by the minor 5.4- and 6.8-kb mRNAs and the variant proteins are encoded by the major 2.6-kb mRNA. Relative quantities of these mRNAs were determined by RNase protection assay, and the ratio of the receptor mRNAs to the variant mRNAs was estimated to be 1:6 in adult brain. The ratio between the mRNAs was regulated in both a tissue-specific and developmental stage-specific manner. The receptor mRNA levels were also regulated by the thyroid state of the animal showing an increased level in hypothyroid rat liver while those in brain were not affected. Analysis of the alpha-thyroid hormone receptor gene suggested that the choice between two poly-adenylation sites and subsequent RNA processing appear to generate the 3' heterogeneity of these alternative mRNAs.
...
PMID:Regulation of expression of the alternative mRNAs of the rat alpha-thyroid hormone receptor gene. 272 6

Retinoids are metabolites of vitamin A that can regulate gene expression in a range of embryonic and adult cell types. They do this by binding to nuclear receptors belonging to the steroid/thyroid hormone receptor superfamily of ligand-activated transcription factors. Vertebrates possess two classes of nuclear retinoid-receptor genes, each with three members. These are the RAR-alpha, RAR-beta and RAR-gamma genes and the RXR-alpha, RXR-beta and RXR-gamma genes. In this paper we show by cDNA cloning and ribonuclease protection that the chicken RXR-gamma gene gives rise to two mRNA species (RXR-gamma 1 and RXR-gamma 2) that differ at their 5' ends. The two mRNAs have different tissue distributions in the 10-day-old chick embryo. RXR-gamma 2 mRNA was present in the eye and dorsal root ganglia but was undetectable in the liver. In contrast, RXR-gamma 1 mRNA was present in liver, was undetectable in dorsal root ganglia and was just detectable in the eye, where it was much less abundant than RXR-gamma 2 mRNA. The predicted protein products of the RXR-gamma 1 and RXR-gamma 2 mRNAs differ at their N-termini, in a region thought to modulate transcriptional transactivation by the receptor. These results show that at least one of the retinoid-X-receptor (RXR) genes gives rise to more than one protein product, a principle previously established for the retinoic acid-receptor (RAR) genes. The existence of multiple RXR protein isoforms would increase the range of heterodimers formed between RXRs and other nuclear receptors, including RARs and the receptors for thyroid hormone, vitamin D and peroxisome proliferators. This could increase the diversity of transcriptional responses mediated by these molecules.
...
PMID:The chicken retinoid-X-receptor-gamma gene gives rise to two distinct species of mRNA with different patterns of expression. 803 82

Many postembryonic developmental processes are regulated by an intricate interplay among hormones and growth factors. Thyroid hormone (TH) and estrogen are well known to be individually and obligatorily required for the initiation and progression of amphibian metamorphosis and vitellogenesis. However, whether or not a possible interplay between these two hormones would affect these two developmental processes is not known. Here we report on how triiodothyronine (T3) enhances the precocious activation of vitellogenin (Vit) genes by estradiol (E2) in Xenopus tadpoles during metamorphosis. Using a combination of filter hybridization, RNase protection assay and in situ hybridization, we first show that very low doses (10(-9) M) of exogenous T3 will autoinduce thyroid hormone receptor (TR) mRNA in several tissues of premetamorphic tadpoles. The same treatment enhances and accelerates the precocious activation of the silent vitellogenin genes by E2 at metamorphic climax (stages 60-64) but not before mid-metamorphosis (stages 56-58). This developmental stage dependency may be explained by our finding that, under the same experimental conditions, T3 fails to alter the autoinduction of ER mRNA at mid-metamorphosis but strongly potentiates it at metamorphic climax. Thus a developmental stage specific interplay between thyroid hormone and estrogen determines the kinetics and extent of activation of vitellogenin and estrogen receptor genes during Xenopus postembryonic development.
...
PMID:Interplay between thyroid hormone and estrogen in modulating expression of their receptor and vitellogenin genes during Xenopus metamorphosis. 818 48

Impairment of growth is a hallmark of hypothyroidism in animals. The ability of the thyroid hormone-thyroid hormone receptor complex to regulate gene transcription may be relevant to the growth impairment associated with hypothyroidism. To study the role of thyroid hormone in the expression of the GH receptor (GHR) and GH-binding protein (GHBP) gene, we examined the serum and liver tissue of female and male hypothyroid (thyroidectomized), thyroxine-treated thyroidectomized and euthyroid control rats. Compared to the control and to the thyroxine-treated group, the hypothyroid rats had significantly lower serum levels of thyroxine, increased levels of TSH, and decreased rates of weight gain. GHR and GHBP mRNA levels in liver were estimated by ribonuclease protection assays. In female rats, the levels of hepatic GHR and GHBP mRNA were increased in the hypothyroid group compared to euthyroid controls (p < 0.001 for GHR and p < 0.05 for GHBP). In contrast, in males the hypothyroid state was associated with decreased levels of GHR (p < 0.001) and GHBP (p < 0.001) mRNA levels compared to euthyroid controls. In both females and males, administration of thyroxine for a period of 2 weeks to the thyroidectomized rats prevented these changes in GHR and GHBP mRNA levels in liver. The differences observed between females and males could not be attributed to differences in the circulating levels of GH at sacrifice (female vs. male. 9.9 +/- 1.3 vs. 13.9 +/- 6.5 ng/ml). We conclude that (1) thyroid hormone affects the transcription of the GHR/GHBP gene; (2) there is a distinct sexual dimorphism in the effect of hypothyroidism on the expression of the GHR/GHBP gene, and (3) this effect is reversible following amelioration of the hypothyroid state. We speculate that regulation of expression of the GHR/GHBP gene by thyroid hormones involves multiple thyroid response elements that have opposite effects depending on the status of other factors such as sex hormones.
...
PMID:Distinct sexual dimorphism in the effect of hypothyroidism on the expression of the growth hormone receptor and growth hormone-binding protein gene in rat liver. 879 21

The effects of all-trans-retinoic acid (RA), 9-cis-retinoic acid (9cRA), and thyroid hormone (T3) on GH-releasing hormone receptor (GHRH-R) messenger RNA (mRNA) expression were studied using ribonuclease protection assay in the fetal rat pituitary gland and in MtT/S cells, a clonal GH cell line derived from an estrogen-induced somatotropic tumor in the rat. Although RA (1 microM), 9cRA (1 microM), or T3 (1 nM) alone showed little effect on GHRH-R mRNA expression in the MtT/S cells, each of these substances was found to act synergistically with dexamethasone (DEX; 500 nM) to increase GHRH-R mRNA expression. The effects of RAs and T3 were dose dependent, with maximum effects observed at 1 microM and 1 nM, respectively. The maximum effect of RAs or T3 was not further augmented by the addition of T3 or RAs, respectively. No apparent differences were observed in this study between the actions of RA and 9cRA. The Northern analyses showed that MtT/S cells express retinoic acid receptor alpha2 mRNA and thyroid hormone receptor beta2 mRNA, and DEX did not affect the levels of these mRNAs. This suggests that the role of DEX in enabling RAs or T3 to up-regulate GHRH-R mRNA levels is not an induction of the expression of each specific receptor for RAs and T3. The similar enhancement of DEX induction of GHRH-R mRNA by RAs or T3 was also observed in the fetal rat pituitary gland in culture, suggesting that RA and/or T3 is involved in the mechanisms responsible for the developmentally regulated expression of GHRH-R mRNA.
...
PMID:Retinoic acids and thyroid hormone act synergistically with dexamethasone to increase growth hormone-releasing hormone receptor messenger ribonucleic acid expression. 1110 47

Exposure to cold increases abundance of mRNA for uncoupling protein-3 (UCP3) in skeletal muscle, whereas the influence of exposure to heat is unknown. Thus, we conducted a study to investigate the influence of heat exposure on UCP3 mRNA abundance in porcine skeletal muscle. Three pigs aged 110 to 120 d, with an average BW of 75 kg, from each of eight litters were used. Each littermate was assigned to one of three treatment groups; one group was reared at 32 degrees C and fed ad libitum (32AL) for 4 wk, whereas the other two groups were maintained at 23 degrees C for the same period, and either pair-fed the intake of their 32AL littermates (23PF), or fed ad libitum (23AL). The RNase protection assay revealed that UCP3 mRNA abundance in longissimus dorsi and rhomboideus muscles was higher (P < 0.05) in the 32AL group than the 23PF group. The 23AL group also had significantly higher UCP3 mRNA abundance than the 23PF group in these muscles. Plasma total 3,5,3'-triiodothyronine concentration of the 32AL group was lower (P < 0.05) than that of the 23PF group, whereas mRNA abundance of thyroid hormone receptor (TR) isoforms, TRalpha1 and TRalpha2, in these muscles was not affected, suggesting that the 32AL group was in a relatively hypo-thyroid state. Because thyroid hormone up-regulates UCP3 expression, these results indicate that factors other than thyroid hormone may play a role in regulating UCP3 mRNA abundance in skeletal muscle of heat-exposed pigs.
...
PMID:Effect of heat exposure on uncoupling protein-3 mRNA abundance in porcine skeletal muscle. 1553 69

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.
...
PMID:Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone. 1679 15

Abstract We have used in situ hybridization to investigate estradiol regulation of estrogen receptor (ER) mRNA in regions of the mediobasal hypothalamus which contain ER and are related to specific neuroendocrine functions. Ovariectomized rats were treated with oil or 10 mug estradiol benzoate for 2, 4, 18 or 24 h. Brains were sectioned and hybridized with a [(3) H]single-stranded DNA probe prepared from the pORF cDNA of the human ER gene and exposed to autoradiographic emulsion for 4 months. Specificity of labeling was determined by counting the number of grains over cells in hypothalamic regions known to bind estradiol, compared to cells in the thalamus and cortex, and by comparing with sections pretreated with ribonuclease or hybridized with a [(3) H]single-stranded message-sense (control) probe. Labeling for ER mRNA was distributed differently than glucocorticoid and thyroid hormone receptor mRNAs, and was regulated by estrogen differently than progestin receptor mRNA. These differences indicated specific hybridization for ER mRNA. ER-expressing cells constituted 11.5% of the cells in the dorsomedial nucleus, 30% of the cells in the arcuate nucleus and 43% in the ventromedial nucleus, in close accordance with previous studies of ER autoradiography and binding. Quantitative analysis showed that the highest level of ER mRNA was present in the ovariectomized controls. ER mRNA levels fell 42% (ventromedial), 64% (arcuate), or remained unchanged (dorsomedial) 18 h following estradiol benzoate treatment. The pattern of decrease was similar for cells in the ventromedial nucleus and arcuate nucleus. These data show that estrogen regulation of ER mRNA in brain parallels that reported for MCF-7 cells and rat uterus. These results also demonstrate that in situ hybridization can be used to detect and measure the relative level of a low abundance mRNA in a heterogeneous tissue in which only 12% to 40% of the cells in limited regions express the message.
...
PMID:Estradiol Regulation of Estrogen Receptor Messenger Ribonucleic Acid in Rat Mediobasal Hypothalamus: An in situ Hybridization Study. 1921 95