Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:3.1.26.9 (ribonuclease)
6,589 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Eukaryotic RNA polymerase II and Escherichia coli RNA polymerase possess an intrinsic ribonuclease activity that is stimulated by the polymerase-binding proteins SII and GreB, respectively. This factor-activated hydrolysis of nascent RNA has been postulated to be involved in transcription elongation as well as removal of incorrect bases misincorporated into RNA. Little is known about the frequency of misincorporation by RNA polymerases in vivo or about the mechanisms involved in improving RNA polymerase accuracy. Here we have developed a luciferase reporter system in an effort to assay for base misincorporation in living Saccharomyces cerevisiae. The assay employs a luciferase open reading frame that contains a premature stop codon. The inactive truncated enzyme would become active if misincorporation by RNA polymerase II took place at the stop triplet. Yeast lacking SII did not display a significant change in reporter activity when compared with wild-type cells. We estimate that under our assay conditions, mRNAs with a misincorporation at the test site could not exceed 1 transcript per 500 cells. The reporter assay was very effective in detecting the previously described process of nonsense suppression (translational read-through) by ribosomes, making it difficult to determine an absolute level of basal (SII-independent) misincorporation by RNA polymerase II. Although these data cannot exclude the possibility that SII is involved in proofreading, they make it unlikely that such a contribution is physiologically significant, especially relative to the high frequency of translational errors.
...
PMID:Use of an in vivo reporter assay to test for transcriptional and translational fidelity in yeast. 1200 89

The 3' untranslated region (UTR) of rTSalpha RNA is complementary (i.e., antisense) to human thymidylate synthase (TS) RNA. When HEp2 cells (human epidermoid carcinoma) progressed from late-log to plateau phase growth, ribonuclease protection assay (RPA) revealed an inverse correlation between the levels of rTSalpha RNA and TS mRNA, suggesting a possible effect of rTSalpha RNA on TS mRNA levels. HEp2 cells expressing a Tet-On transactivator were transiently co-transfected with pHook-1 and a construct containing rTSalpha (protein and antisense RNA), rTSalphaDelta3' (rTSalpha protein only), rTSalpha-3' (antisense RNA-luciferase) or luciferase. Transfected cells were selected and evaluated for the effects of induced transgene expression on TS mRNA. Induced expression of transfected rTSalpha or rTSalpha-3', but not rTSalphaDelta3' or luciferase, resulted in decreased TS mRNA levels as measured by RPA. These results demonstrated that the antisense region of rTSalpha RNA is necessary and sufficient for this down-regulation of TS mRNA. RPA for TS mRNA also showed the enhanced appearance of two partial-length protected fragments in rTSalpha or rTSalpha-3' transfected cells. RPA stringency evaluations and primer extension assays indicated that TS mRNA is cleaved in vivo in a site-specific manner. These data demonstrate that rTS gene expression likely plays a role in down-regulating TS through a natural RNA-based antisense mechanism.
...
PMID:Natural antisense (rTSalpha) RNA induces site-specific cleavage of thymidylate synthase mRNA. 1208 60

Ablation of cells by the controlled expression of a lethal gene can be used to engineer plant traits such as male sterility and disease resistance. However, it may not be possible to achieve sufficient specificity of expression to prevent secondary effects in non-targeted tissues. In this paper we demonstrate that the extracellular ribonuclease, barnase, can be engineered into two complementary fragments, allowing overlapping promoter specificity to be used to enhance targeting specificity. Using a transient system, we first show that barnase can be split into two inactive peptide fragments, that when co-expressed can complement each other to reconstitute barnase activity. When a luciferase reporter gene was introduced into plant cells along with genes encoding both partial barnase peptides, a substantial reduction in luciferase activity was seen. Cytotoxicity of the reconstituted barnase was demonstrated by crossing together parents constitutively expressing each of the barnase fragments, then assaying their progeny for the presence of both partial barnase genes. None of over 300 tomato seeds planted resulted in a viable progeny that inherited both transgenes. When expression of the partial barnase genes was instead targeted to the tapetum, male sterility resulted. All 13 tomato progeny that inherited both transgenes were male sterile, whereas the three progeny inheriting only the N-terminal barnase gene were male fertile. Finally, we describe how male sterility generated by this type of two-component system can be used in hybrid seed production.
...
PMID:A novel, two-component system for cell lethality and its use in engineering nuclear male-sterility in plants. 1210 Apr 87

Multiple ribonucleases are widely found in living organisms, but the function and regulation of individual ribonucleases are still not clear. In the present study, we found that one oocytic ribonuclease, RC-RNase, is developmentally expressed in the liver and stored in the oocyte of the bullfrog, while another ribonuclease, RC-RNase L1, is constitutively expressed and retained in the liver at all stages. In females, the expression of RC-RNase increased with the degree of maturity and the concentration of plasma estradiol during oogenesis. In males, the RC-RNase gene was activated in the liver and the newly synthesized protein was secreted into plasma if estradiol was administered. To investigate the mechanism of estrogen-mediated activation of ribonuclease expression, we cloned the RC-RNase promoter and analyzed the putative transcription factor binding sites, e.g. TATA box, ERE, AP1 and CAAT box. Using luciferase as a reporter gene, we found that an estrogen response element in the promoter of RC-RNase was essential for both basic transcription and estradiol-mediated gene activation in estrogen receptor-positive MCF7 cells. These results support the hypothesis that RC-RNase is synthesized in the liver upon stimulation by estradiol during oogenesis, then secreted into the bloodstream and stored in oocytes for embryonic development.
...
PMID:Regulation of ribonuclease expression by estradiol in Rana catesbeiana (Bullfrog). 1213 11

The aim of the present study was to analyze the functional importance for the parathyroid hormone (PTH)/PTH-related peptide (PTHrP) receptor (PTHR1) gene P2 promoter activity of the putative proximal Myc-associated zinc finger protein (MAZ) site localized at position bp -45 to -39 bp, taking advantage of a G/A mutation identified at position -40 in the human sequence. Wild-type 'full-length' (1285P2) and truncated (760P2) promoter sequences were inserted upstream to the luciferase basic (pLucB) and enhancer (pLucE) reporter gene expression vectors. Transient transfections in osteoblast-like SaOS-2 cells and renal cells (RC.SV3A2) showed that the -40 G/A mutation significantly impaired transcriptional activity of wild-type 1285P2-pLucB and 760P2-pLucE promoter constructs. Further truncation of the P2 sequence demonstrated that the sequence -109/-37 bp was essential for promoter activity. Co-transfection with a MAZ expression vector did not modify the wild-type 1285P2-pLucB construct reporter activity but significantly increased 2-fold the mutated construction activity (P<0.05). Electrophoretic mobility shift assays using SaOS-2 nuclear extracts and a double-stranded DNA fragment encompassing the -45 to -39 putative MAZ site (ds-MAZ-oligo) disclosed two specific DNA-protein complexes. Complex II (fast moving) had a lower affinity for the mutated MAZ motif than for the wild-type MAZ motif while complex I (slow moving) had the same affinity for both wild-type or mutated MAZ sequences. Competition studies with Sp1 consensus oligonucleotide (ds-Sp1-oligo) markedly reduced complex I intensity, with a concomitant increase in that of complex II. Finally, ribonuclease protection assays showed that P2-specific PTHR1 mRNA transcript expression was significantly decreased in SaOS-2 cells transfected with ds-MAZ-oligo as compared with that for control (P<0.001) and ds-Sp1-oligo (P<0.05). Taken together, our studies suggest that the putative -45 to -39 MAZ-binding site regulates the constitutive activity of human PTHR1 P2 promoter.
...
PMID:Functional importance of Myc-associated zinc finger protein for the human parathyroid hormone (PTH)/PTH-related peptide receptor-1 P2 promoter constitutive activity. 1476 95

Endothelial cells are the primary targets of circulating immune and inflammatory mediators. We hypothesize that interleukin-18, a proinflammatory cytokine, induces endothelial cell apoptosis. Human cardiac microvascular endothelial cells (HCMEC) were treated with interleukin (IL) 18. mRNA expression was analyzed by ribonuclease protection assay, protein levels by immunoblotting, and cell death by enzyme-linked immunosorbent assay and fluorescence-activated cell sorter analysis. We also investigated the signal transduction pathways involved in IL-18-mediated cell death. Treatment of HCMEC with IL-18 increases 1) NF-kappaB DNA binding activity; 2) induces kappaB-driven luciferase activity; 3) induces IL-1beta and TNF-alpha expression via NF-kappaB activation; 4) inhibits antiapoptotic Bcl-2 and Bcl-X(L); 5) up-regulates proapoptotic Fas, Fas-L, and Bcl-X(S) expression; 6) induces fas and Fas-L promoter activities via NF-kappaB activation; 7) activates caspases-8, -3, -9, and BID; 8) induces cytochrome c release into the cytoplasm; 9) inhibits FLIP; and 10) induces HCME cell death by apoptosis as seen by increased annexin V staining and increased levels of mono- and oligonucleosomal fragmented DNA. Whereas overexpression of Bcl-2 significantly attenuated IL-18-induced endothelial cell apoptosis, Bcl-2/Bcl-X(L) chimeric phosphorothioated 2'-MOE-modified antisense oligonucleotides potentiated the proapoptotic effects of IL-18. Furthermore, caspase-8, IKK-alpha, and NF-kappaB p65 knockdown or dominant negative IkappaB-alpha and dominant negative IkappaB-beta or kinase dead IKK-beta significantly attenuated IL-18-induced HCME cell death. Effects of IL-18 on cell death are direct and are not mediated by intermediaries such as IL-1beta, tumor necrosis factor-alpha, or interferon-gamma. Taken together, our results indicate that IL-18 activates both intrinsic and extrinsic proapoptotic signaling pathways, induces endothelial cell death, and thereby may play a role in myocardial inflammation and injury.
...
PMID:Activation of intrinsic and extrinsic proapoptotic signaling pathways in interleukin-18-mediated human cardiac endothelial cell death. 1496 May 79

Rat immune-associated nucleotide 4-like 1 (Ian4l1) encodes an antiapoptotic protein, which is essential for T-cell survival. A frameshift mutation at codon 85 in the biobreeding diabetes-prone (BBDP) rat is the cause of their life-long T-cell lymphopenia, which includes lack of regulatory T-cells--a prerequisite for spontaneous autoimmune destruction of their beta-cells. This study reports the identification of seven Ian4l1 mRNA variants. The genomic organization of the exons indicates three promoter regions. The promoter of two of the mRNAs was characterized. Rapid amplification of cDNA ends (RACE) and ribonuclease protection assay (RPA) demonstrated multiple transcription start sites (TSS) with two major sites. The localization of the core promoter and regulatory regions was identified by a luciferase assay of the 2.7-kb upstream of the TSS. The regulatory regions functioned similarly in two cell lines--one expressing Ian4l1 and one not expressing it. This indicates that the cell-specific expression is controlled by regions outside the 2.7-kb region, or by the chromatin structure or chromatin methylation level. The core promoter is TATA-less and initiator element-less, and contains putative binding sites for YY1, Sp1, and MED-1, the latter being an element believed to be important for transcription from TATA-less promoters.
...
PMID:The antiapoptotic gene Ian4l1 in the rat: genomic organization and promoter characterization. 1547 97

MicroRNAs play important roles in regulating development at both transcriptional and posttranscriptional levels. Here, we report 29 microRNAs from mouse testis that are differentially expressed as the prepubertal testis differentiates to the adult testis. Using computational analyses to identify potential microRNA target mRNAs, we identify several possible male germ cell target mRNAs. One highly conserved sequence in the 3'-untranslated region (UTR) of transition protein 2 (Tnp2) mRNA, a testis-specific and posttranscriptionally regulated mRNA in postmeiotic germ cells, is complementary to Mirn122a. Mirn122a is enriched in late-stage male germ cells and is predominantly on polysomes. Mirn122a, but not another noncomplementary microRNA, inhibits the activity of a luciferase reporter construct containing the 3'-UTR of Tnp2. Site-directed mutations of Mirn122a indicate that base pairing of the 5'-region of Mirn122a to its complementary site in the 3'-UTR of Tnp2 mRNA is essential for the downregulation of luciferase activity. Real-time reverse transcription-polymerase chain reaction and ribonuclease protection assays reveal that the Mirn122a-directed decrease of the Tnp2 reporter gene activity results from mRNA cleavage. We propose that specific microRNAs, such as Mirn122a, could be involved in the posttranscriptional regulation of mRNAs such as Tnp2 in the mammalian testis.
...
PMID:MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage. 1590 36

CRH-binding protein (CRH-BP) binds CRH with high affinity and inhibits CRH-mediated ACTH release from anterior pituitary corticotrope-like cells in vitro. In female mouse pituitary, CRH-BP is localized not only in corticotropes, but is also expressed in gonadotropes and lactotropes. To investigate the functional significance of gonadotrope CRH-BP, we examined the molecular mechanisms underlying GnRH-regulated CRH-BP expression in alphaT3-1 gonadotrope-like cells. CRH-BP is endogenously expressed in alphaT3-1 cells, and quantitative real-time RT-PCR and ribonuclease protection assays demonstrate that GnRH induces a 3.7-fold increase in CRH-BP mRNA levels. GnRH also induces intracellular CRH-BP (2.0-fold) and secreted CRH-BP (5.3-fold) levels, as measured by [125I]CRH:CRH-BP chemical cross-linking. Transient transfection assays using CRH-BP promoter-luciferase constructs indicate that GnRH regulation involves protein kinase C-, ERK- and calcium-dependent signaling pathways and is mediated via a multipartite GnRH response element that includes activator protein 1 and cAMP response element (CRE) sites. The CRE site significantly contributes to GnRH responsiveness, independent of protein kinase A, representing a unique form of multipartite GnRH regulation in alphaT3-1 cells. Furthermore, EMSAs indicate that alphaT3-1 nuclear proteins specifically bind at activator protein 1 and CRE sites. These data demonstrate novel regulation of pituitary CRH-BP, highlighting the importance of the pituitary gonadotrope as a potential interface between the stress and reproductive axes.
...
PMID:Gonadotropin-releasing hormone (GnRH) positively regulates corticotropin-releasing hormone-binding protein expression via multiple intracellular signaling pathways and a multipartite GnRH response element in alphaT3-1 cells. 1597 7

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.
...
PMID:Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone. 1679 15


<< Previous 1 2 3 4 5 6 Next >>

---