Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.26.9 (ribonuclease)
6,589 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The hypothesis that growth hormone (GH) can affect immune responses in man has been evaluated by monitoring cytokine expression in cultures from peripheral blood mononuclear cells, by enzyme-linked immunosorbent assay (ELISA) and ribonuclease protection assay, and in tonsillar cells by ELISA. In addition to pituitary GH (GH-N), the placental form (GH-V), differing from pituitary GH by 13 amino acids has also been tested. Only few effects reached statistical significance and were in no case greater than 15%. Pituitary GH slightly reduced IL-5 production and stimulated IFN-gamma production. The latter effect was also observed with prolactin and could thus be induced through the prolactin receptor. It is proposed that GH has no strong effects on the parameters investigated, possibly as a result of redundancy in the cytokine network. Alternatively, effects on leukocytes are mediated by other tissues such as the liver or are clear only in response to stronger challenges.
...
PMID:Limited effects of placental and pituitary growth hormone on cytokine expression in vitro. 1102 31

Growth hormone (GH) regulates the expression of many genes in the liver, and for some genes this regulation may be mediated through liver-enriched transcription factors (LETFs). As part of the long-term goal to investigate the role of LETFs in GH regulation of gene expression in the liver, in this study we determined the effect of GH administration on the expression of 10 LETFs, including hepatocyte nuclear factor (HNF)-1alpha, HNF-1beta, HNF-3alpha, HNF-3beta, HNF-3gamma, HNF-4alpha, HNF-6, CCAAT/enhancer-binding protein (C/EBP) alpha, C/EBPbeta, and albumin D-element binding protein (DBP) in the bovine liver. Eighteen non-lactating and non-pregnant Angus cows were assigned randomly to three groups (n=6 per group) and each cow received a single intramuscular injection of 500 mg slow-release recombinant bovine GH. Liver biopsy samples were taken from group 1 cows 6 h after GH administration, from group 2 cows 24 h after GH administration, and from group 3 cows 1 week after GH administration. Liver biopsies were also collected from group 3 cows 1 day before GH administration, serving as pre-GH controls. The LETF mRNAs in these liver samples were quantified using ribonuclease protection assays with probes generated from bovine LETF cDNAs cloned by standard reverse transcription-polymerase chain reaction. The levels of HNF-3gamma and HNF-6 mRNAs were higher (P< 0.05) in the cows 24 h and 1 week after GH administration than in the untreated cows or the cows 6 h after GH administration. The levels of HNF-4alpha mRNA were higher (P< 0.05) in the cows 1 week after GH administration than in the other three groups of cows. The levels of C/EBPalpha mRNA were higher (P< 0.05) in the cows 24 h after GH administration than in the untreated cows or the cows 6 h after GH administration. The levels of HNF-3alpha mRNA were higher (P< 0.05) in the cows 6 h after GH administration but were lower (P< 0.05) in the cows 24 h or 1 week after GH administration compared with those in the untreated cows. The levels of DBP mRNA were higher (P< 0.05) in the cows 6 h after GH administration but were lower (P< 0.05) in the cows 24 h after GH administration compared with those in the untreated cows. The levels of HNF-1alpha, HNF-3alpha, and C/EBPbeta mRNAs were not different (P>0.05) between groups. The expression of HNF-1beta mRNA was not detectable. Thus, the expression of six LETFs including HNF-3gamma , HNF-3beta, HNF-4alpha, HNF-6, C/EBPalpha, and DBP mRNAs in the bovine liver is regulated by GH, and these six LETFs may play a role in mediating GH regulation of gene expression in the liver. Among the 10 LETFs, the response of HNF-3gamma to GH is most significant. Cloning and sequencing the promoter region of this gene revealed multiple putative binding elements for signal transducers and activators of transcription 5 (STAT5), suggesting that GH regulation of HNF-3gamma expression in the liver may be mediated through direct binding of STAT5 to the HNF-3gamma promoter.
...
PMID:Growth hormone regulates the expression of hepatocyte nuclear factor-3 gamma and other liver-enriched transcription factors in the bovine liver. 1564 87

Cartilage-hair hypoplasia (CHH) is an autosomal recessive metaphyseal chondrodysplasia characterized by severe short-limb short stature and hypoplastic hair. The responsible gene for CHH has been identified to be ribonuclease of mitochondrial RNA-processing (RMRP) gene. We examined RMRP genes of a 3-year-old Japanese CHH boy and his family and revealed a novel mutation: 20 bp duplication (TACTCTGTGAAGCTGAGGAC), in promoter region of maternal allele, at nucleotide -3 and a reported 218A>G point mutation in transcribed region of paternal allele. No treatment for CHH has been established so far. Growth hormone (GH) action has its effect on linear growth and on bone remodeling and homeostasis. Recently, GH has been used to improve severe short stature caused by not only GH deficiency (GHD) but also some skeletal dysplasias including achondroplasia. To improve severe short stature, we treated the patient with 0.175 mg kg-1 week-1 of GH for 7 years. His height was improved from -4.2 SD to -3.0 SD by 1 year of GH treatment. Following treatment had given positive effects continuously on his height to -2.6 SD by 3.1 years GH medication. Then, when he was 6 years old, surgical lengthening was performed and his height reached to -2.0 SD. After the surgery, we continued GH treatment. Additional GH treatment of 3.6 more years had kept his height to -2.0 SD. However, when he was 8 years old, because there was an interruption of GH treatment, the velocity of his height was obviously decreased comparing before and during the interruption, which was calculated 3.4 and 2.2 cm/year, respectively, and the SD score was decreased to -2.1 SD. This result of total 7 years of GH treatment suggested that GH treatment significantly improved his disturbed bone growth and had also positive efficacy to keep growth rate. This result implies the connection between GH signal and RMRP gene. Additionally, GH may be considered to be an efficient treatment for CHH.
...
PMID:An effective case of growth hormone treatment on cartilage-hair hypoplasia. 1578 Sep 58