Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.26.9 (ribonuclease)
 6,589 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Retinoids are metabolites of vitamin A that can regulate gene expression in a range of embryonic and adult cell types. They do this by binding to nuclear receptors belonging to the steroid/thyroid hormone receptor superfamily of ligand-activated transcription factors. Vertebrates possess two classes of nuclear retinoid-receptor genes, each with three members. These are the RAR-alpha, RAR-beta and RAR-gamma genes and the RXR-alpha, RXR-beta and RXR-gamma genes. In this paper we show by cDNA cloning and ribonuclease protection that the chicken RXR-gamma gene gives rise to two mRNA species (RXR-gamma 1 and RXR-gamma 2) that differ at their 5' ends. The two mRNAs have different tissue distributions in the 10-day-old chick embryo. RXR-gamma 2 mRNA was present in the eye and dorsal root ganglia but was undetectable in the liver. In contrast, RXR-gamma 1 mRNA was present in liver, was undetectable in dorsal root ganglia and was just detectable in the eye, where it was much less abundant than RXR-gamma 2 mRNA. The predicted protein products of the RXR-gamma 1 and RXR-gamma 2 mRNAs differ at their N-termini, in a region thought to modulate transcriptional transactivation by the receptor. These results show that at least one of the retinoid-X-receptor (RXR) genes gives rise to more than one protein product, a principle previously established for the retinoic acid-receptor (RAR) genes. The existence of multiple RXR protein isoforms would increase the range of heterodimers formed between RXRs and other nuclear receptors, including RARs and the receptors for thyroid hormone, vitamin D and peroxisome proliferators. This could increase the diversity of transcriptional responses mediated by these molecules.
 ...
PMID:The chicken retinoid-X-receptor-gamma gene gives rise to two distinct species of mRNA with different patterns of expression. 803 82

Impairment of growth is a hallmark of hypothyroidism in animals. The ability of the thyroid hormone-thyroid hormone receptor complex to regulate gene transcription may be relevant to the growth impairment associated with hypothyroidism. To study the role of thyroid hormone in the expression of the GH receptor (GHR) and GH-binding protein (GHBP) gene, we examined the serum and liver tissue of female and male hypothyroid (thyroidectomized), thyroxine-treated thyroidectomized and euthyroid control rats. Compared to the control and to the thyroxine-treated group, the hypothyroid rats had significantly lower serum levels of thyroxine, increased levels of TSH, and decreased rates of weight gain. GHR and GHBP mRNA levels in liver were estimated by ribonuclease protection assays. In female rats, the levels of hepatic GHR and GHBP mRNA were increased in the hypothyroid group compared to euthyroid controls (p < 0.001 for GHR and p < 0.05 for GHBP). In contrast, in males the hypothyroid state was associated with decreased levels of GHR (p < 0.001) and GHBP (p < 0.001) mRNA levels compared to euthyroid controls. In both females and males, administration of thyroxine for a period of 2 weeks to the thyroidectomized rats prevented these changes in GHR and GHBP mRNA levels in liver. The differences observed between females and males could not be attributed to differences in the circulating levels of GH at sacrifice (female vs. male. 9.9 +/- 1.3 vs. 13.9 +/- 6.5 ng/ml). We conclude that (1) thyroid hormone affects the transcription of the GHR/GHBP gene; (2) there is a distinct sexual dimorphism in the effect of hypothyroidism on the expression of the GHR/GHBP gene, and (3) this effect is reversible following amelioration of the hypothyroid state. We speculate that regulation of expression of the GHR/GHBP gene by thyroid hormones involves multiple thyroid response elements that have opposite effects depending on the status of other factors such as sex hormones.
 ...
PMID:Distinct sexual dimorphism in the effect of hypothyroidism on the expression of the growth hormone receptor and growth hormone-binding protein gene in rat liver. 879 21

The effects of all-trans-retinoic acid (RA), 9-cis-retinoic acid (9cRA), and thyroid hormone (T3) on GH-releasing hormone receptor (GHRH-R) messenger RNA (mRNA) expression were studied using ribonuclease protection assay in the fetal rat pituitary gland and in MtT/S cells, a clonal GH cell line derived from an estrogen-induced somatotropic tumor in the rat. Although RA (1 microM), 9cRA (1 microM), or T3 (1 nM) alone showed little effect on GHRH-R mRNA expression in the MtT/S cells, each of these substances was found to act synergistically with dexamethasone (DEX; 500 nM) to increase GHRH-R mRNA expression. The effects of RAs and T3 were dose dependent, with maximum effects observed at 1 microM and 1 nM, respectively. The maximum effect of RAs or T3 was not further augmented by the addition of T3 or RAs, respectively. No apparent differences were observed in this study between the actions of RA and 9cRA. The Northern analyses showed that MtT/S cells express retinoic acid receptor alpha2 mRNA and thyroid hormone receptor beta2 mRNA, and DEX did not affect the levels of these mRNAs. This suggests that the role of DEX in enabling RAs or T3 to up-regulate GHRH-R mRNA levels is not an induction of the expression of each specific receptor for RAs and T3. The similar enhancement of DEX induction of GHRH-R mRNA by RAs or T3 was also observed in the fetal rat pituitary gland in culture, suggesting that RA and/or T3 is involved in the mechanisms responsible for the developmentally regulated expression of GHRH-R mRNA.
 ...
PMID:Retinoic acids and thyroid hormone act synergistically with dexamethasone to increase growth hormone-releasing hormone receptor messenger ribonucleic acid expression. 1110 47

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.
 ...
PMID:Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone. 1679 15

Abstract We have used in situ hybridization to investigate estradiol regulation of estrogen receptor (ER) mRNA in regions of the mediobasal hypothalamus which contain ER and are related to specific neuroendocrine functions. Ovariectomized rats were treated with oil or 10 mug estradiol benzoate for 2, 4, 18 or 24 h. Brains were sectioned and hybridized with a [(3) H]single-stranded DNA probe prepared from the pORF cDNA of the human ER gene and exposed to autoradiographic emulsion for 4 months. Specificity of labeling was determined by counting the number of grains over cells in hypothalamic regions known to bind estradiol, compared to cells in the thalamus and cortex, and by comparing with sections pretreated with ribonuclease or hybridized with a [(3) H]single-stranded message-sense (control) probe. Labeling for ER mRNA was distributed differently than glucocorticoid and thyroid hormone receptor mRNAs, and was regulated by estrogen differently than progestin receptor mRNA. These differences indicated specific hybridization for ER mRNA. ER-expressing cells constituted 11.5% of the cells in the dorsomedial nucleus, 30% of the cells in the arcuate nucleus and 43% in the ventromedial nucleus, in close accordance with previous studies of ER autoradiography and binding. Quantitative analysis showed that the highest level of ER mRNA was present in the ovariectomized controls. ER mRNA levels fell 42% (ventromedial), 64% (arcuate), or remained unchanged (dorsomedial) 18 h following estradiol benzoate treatment. The pattern of decrease was similar for cells in the ventromedial nucleus and arcuate nucleus. These data show that estrogen regulation of ER mRNA in brain parallels that reported for MCF-7 cells and rat uterus. These results also demonstrate that in situ hybridization can be used to detect and measure the relative level of a low abundance mRNA in a heterogeneous tissue in which only 12% to 40% of the cells in limited regions express the message.
 ...
PMID:Estradiol Regulation of Estrogen Receptor Messenger Ribonucleic Acid in Rat Mediobasal Hypothalamus: An in situ Hybridization Study. 1921 95