Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.26.4 (RNase H)
 2,751 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Expression of beta interferon (IFN-beta) is transiently induced when Namalwa B cells (Burkitt lymphoma cell line) are infected by Sendai virus. In this study, we found that an elongation of the IFN-beta mRNA could be detected in virus-infected cells and that such a modification was not observed when the IFN-beta transcript was induced by a nonviral agent, poly(I-C). Treatment of the cells with a transcriptional inhibitor (actinomycin D or 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole) resulted in further elongation of the transcript. Characterization of the elongated IFN-beta transcript by primer extension and RNase H treatment showed that the modification was a result of an elongated poly(A) tail of up to 400 nucleotides. We conclude that the poly(A) tail elongation of the IFN-beta transcript is associated with the viral infection. Furthermore, the presence of the elongated IFN-beta transcript correlated with a decrease of IFN-beta protein in the medium and in cell extracts. Sucrose gradient analysis of cytoplasmic extracts showed that IFN-beta transcripts with elongated poly(A) tails were found in the nonpolysomal fractions, whereas the shorter transcripts could be detected in both polysomal and nonpolysomal fractions. A longer form of the IFN-beta mRNA was also found in the nonpolysomal fractions of cells not treated with transcriptional inhibitors. Thus, the observed regulation of IFN-beta mRNA is not entirely dependent on the inhibition of transcription. To our knowledge, this study provides the first example of a poly(A) tail elongation in somatic cells that negatively influences gene expression in vivo.
 ...
PMID:Repression of beta interferon gene expression in virus-infected cells is correlated with a poly(A) tail elongation. 855 72

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.
 ...
PMID:Homologous human and murine antisense oligonucleotides targeting stat6. Functional effects on germline cepsilon transcript. 1057 70