Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.26.4 (RNase H)
 2,751 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The cytokine network is involved in normal immune reaction and in the progression of several pathologies. Antisense (AS) oligonucleotides, which allow specific inhibition of expression of proteins, offer a new methodology to investigate this complex network. This review focuses on the use of AS to modulate cytokine expression. AS may act in different ways such as blocking fixation or progression of the ribosome along the mRNA, mRNA cleavage by RNase H, or preventing normal RNA maturation. In order to improve AS efficiency, chemical modifications have been developed, and improvement of oligonucleotide uptake has been achieved with different systems of vectorization including liposomes (neutral, cationic, immunoliposome), nanoparticles, or covalent attachment of a carrier. In oncogenesis, intracellular or extracellular autocrine loops have been demonstrated by the use of cytokine AS. Involvement of cytokines in immunological reactions (TH1 and TH2 subset, IgE response, lymphokine activated killer, cytotoxic T lymphocyte...) and in hematopoiesis have also been studied with this approach. Therapeutic application of AS has been suggested by inhibition of inflammatory cytokines in vivo. Clinical trials using AS are under investigation in virological and in oncological diseases. At present, cytokine antisenses primarily represent a tool for dissecting the function of a cytokine in vitro, but they may offer in the future a new way for immunomodulation intervention.
 ...
PMID:Immunomodulation by cytokine antisense oligonucleotides. 779 78

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.
 ...
PMID:Homologous human and murine antisense oligonucleotides targeting stat6. Functional effects on germline cepsilon transcript. 1057 70