Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:3.1.26.4 (RNase H)
 2,751 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

T helper cells have recently been divided into two subsets. The Th1 subset secretes and responds to IL-2 in an autocrine manner. The Th2 subset upon mitogen or antigen stimulation releases IL-4. Here we describe a novel technology that allowed us to confirm this distinction. We have used synthetic oligonucleotides complementary to the 5' end of mouse IL-2 and IL-4 to specifically block the biosynthesis of IL-2 or IL-4 in two murine helper T cell clones from the Th1 or Th2 subset. We show that the antisense IL-2 oligonucleotide inhibited the proliferation of the Th1 clone and had no effect on the Th2 clone. In parallel experiments, the antisense IL-4 oligonucleotide blocked the proliferation of the Th2 clone and not the proliferation of the Th1 clone. The inhibition was significantly reversed in both cases by the addition of the relevant lymphokine (IL-2 in the case of the Th1 clone, IL-4 in the case of the Th2 clone). Northern analysis, using cDNA probes specific for the two lymphokines, showed a decrease in the steady-state level of the relevant lymphokine mRNA, suggesting the specific degradation of the mRNA by an RNase H-like enzymatic activity. This strategy, which allows the specific blockade of the biosynthesis of a lymphokine, could be useful for future studies on the role of each T helper subset in physiological immune responses.
 ...
PMID:Specific inhibition of lymphokine biosynthesis and autocrine growth using antisense oligonucleotides in Th1 and Th2 helper T cell clones. 297 66

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.
 ...
PMID:Homologous human and murine antisense oligonucleotides targeting stat6. Functional effects on germline cepsilon transcript. 1057 70