Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:3.1.21.1 (DNase)
7,655 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Recombinant adeno-associated virus 2 (AAV) virions were constructed that contained the genomic copy of a normal human beta-globin gene marked with a 4-bp Clal linker, and the herpesvirus thymidine kinase (TK) promoter-driven bacterial gene for resistance to neomycin (v beta m-globin), as well as those containing the DNase l-hypersensitive site 2 (HS-2) from the locus control region (LCR) of the human beta-globin gene cluster (vHS2-beta m-globin). These recombinant virions were used to infect a human erythroleukemia cell line which normally does not express the beta-globin gene (K562), or a human nasopharyngeal carcinoma cell line (KB). Cell populations resistant to G418, a neomycin analogue, were obtained following infections with the recombinant virions, indicating high-efficiency transduction of the chimeric gene as well as functional activity of the transduced neo gene in both cell types. Southern blot analysis using a human beta-globin DNA probe substantiated stable integration of the exogenous beta-globin allele in these cells. There was no expression of the transduced beta-globin gene in K562 or KB cells infected with the v beta m-globin virus. High-level expression of the transduced beta-globin gene occurred only in the vHS2-beta m-globin virus-infected K562 cells, but not in KB cells, as determined by Northern blot as well as RNase protection analyses. Expression of the human beta-globin protein could also be detected in approximately 10-20% of the vHS2-beta m-globin virus-infected K562 cells. These studies suggest that the AAV-based vector system may prove useful for high-efficiency globin gene transfer in human hematopoietic cells.
...
PMID:Adeno-associated virus 2-mediated transduction and erythroid cell-specific expression of a human beta-globin gene. 864 53

The various antigen complexes of the Epstein-Barr virus (EBV) are broadly classified as the viral capsid antigen (VCA), diffuse early antigen (EA-D), restricted early antigen (EA-R), membrane antigen (MA) and the Epstein-Barr nuclear antigen (EBNA). The different EBV-related diseases may be differentiated according to the reactivity of these different classes of antibodies towards the various classes of antigen complexes. However, with the recent development of molecular biology, it is now known that the individual polypeptides of the different EBV antigen complexes can be used as serological markers for the detection of nasopharyngeal carcinoma (NPC). Among the useful serological markers which have been used in enzyme-linked immunosorbent assay (ELISA) for the detection of NPC are the gp125 from the VCA complex (IgA), pp58 from the EA-D complex (IgG), ribonucleotide reductase (IgG and IgA), DNase (IgA) and thymidine kinase (IgA) from the EA-R complex, gp 250/200 from the MA complex (IgA) and the ZEBRA antigen (IgA).
...
PMID:Molecular diagnosis of nasopharyngeal carcinoma: a review. 877 50

Glucocorticoids inhibit transcription of the murine cytoplasmic thymidine kinase gene (Tk-1). Glucocorticoid regulation of Tk-1 transcription can be demonstrated in cells that are arrested in late G1. This observation indicates that inhibition of Tk-1 expression is not dependent upon redistribution within the cell cycle but is due to glucocorticoid regulation of this gene. Transfection studies have been carried out using chimeric genes in which restriction fragments of the Tk-1 promoter were fused to chloramphenicol acetyltransferase or neomycin phosphotransferase. These chimeric reporters were assayed for stable expression and glucocorticoid regulation in P1798 lymphoma cells. A 140-bp fragment, extending from -143 to -3 bp with respect to the thymidine kinase translational start site, was capable of both basal and glucocorticoid-regulated transcription of reporter genes. The extent of inhibition by glucocorticoids was similar to that observed for the endogenous gene, and no increase in basal expression or the extent of inhibition was observed with constructs containing additional 5'-flanking DNA. The 140-bp Tk-1 core promoter fragment binds to transcription factors in extracts from P1798 cells. Control cell extracts contain factors that bind to and protect (from deoxyribonuclease I) a distal promoter element from -106 to -87 bp, relative to the translational start site. A second, proximal element was protected at -43 to -36 bp. The proximal element of the Tk-1 promoter resembles an RNA polymerase II initiator element. No other elements were protected. Glucocorticoids inhibit the amount or activity of the transcription factor that binds to this initiator-like element within the Tk-1 promoter. This element, when fused to upstream activation sequences from the herpes simplex virus thymidine kinase promoter, conveys glucocorticoid sensitivity in cis.
...
PMID:Glucocorticoid regulation of a transcription factor that binds an initiator-like element in the murine thymidine kinase (Tk-1) promoter. 896 Dec 64

A proximal element from the human StAR gene promoter, containing the sequence (-105)TATCCTTGAC(-95), was shown to confer responsiveness to 8-Br-cAMP in the presence of steroidogenic factor 1 (SF-1) when placed behind a minimal thymidine kinase promoter or an SV40 promoter and transfected into BeWo cells which normally lack StAR and SF-1. This element was also transactivated by SF-1 in a yeast one-hybrid system. The -105 to -95 sequence was protected by SF-1 in footprint analysis and a double-stranded oligonucleotide containing the element bound SF-1 specifically in electrophoretic mobility shift assays. Another SF-1-binding sequence 35 bp upstream of the transcription start site ((-42)CAGCCTTC(-35)) was identified in the DNase 1 footprint analysis and, when mutated, markedly reduced SF-1-dependent and 8-Br-cAMP-stimulated StAR promoter activity in BeWo cells. The two proximal SF-1 response elements were shown to be critical for StAR promoter function in human granulosalutein cells, which express SF-1 and respond to cAMP with increased transcription of the StAR gene. Mutation of either element substantially reduced basal and forskolin-stimulated promoter activity, although mutation of the -105 to -95 element had more pronounced effects. Mutation of a third, more distal, SF-1-binding site at -926 to -918 also reduced basal but not forskolin-stimulated promoter activity in the granulosa-lutein cells. These findings demonstrate that multiple SF-1 response elements are required for maximal StAR promoter activity and regulation by cAMP.
...
PMID:Multiple steroidogenic factor 1 binding elements in the human steroidogenic acute regulatory protein gene 5'-flanking region are required for maximal promoter activity and cyclic AMP responsiveness. 918 26

A monkey kidney cDNA that encodes a nuclear regulatory factor was identified by expression and affinity binding to a synthetic retinoic acid response element (RARE) and was used to isolate human placental and rat germ cell cDNAs by hybridization. The cDNAs encode a 59-kDa protein [nuclear DEAF-1-related (NUDR)] which shows sequence similarity to the Drosophila Deformed epidermal autoregulatory factor-1 (DEAF-1), a nonhomeodomain cofactor of embryonic Deformed gene expression. Similarities to other proteins indicate five functional domains in NUDR including an alanine-rich region prevalent in developmental transcription factors, a domain found in the promyelocytic leukemia-associated SP100 proteins, and a zinc finger homology domain associated with the AML1/MTG8 oncoprotein. Although NUDR mRNA displayed a wide tissue distribution in rats, elevated levels of protein were only observed in testicular germ cells, developing fetus, and transformed cell lines. Nuclear localization of NUDR was demonstrated by immunocytochemistry and by a green fluorescent protein-NUDR fusion protein. Site-directed mutagenesis of a nuclear localization signal resulted in cytoplasmic localization of the protein and eliminated NUDR-dependent transcriptional activation. Recombinant NUDR protein showed affinity for the RARE in mobility shifts; however it was efficiently displaced by retinoic acid receptor (RAR)/retinoid X receptor (RXR) complexes. In transient transfections, NUDR produced up to 26-fold inductions of a human proenkephalin promoter-reporter plasmid, with minimal effects on the promoters for prodynorphin or thymidine kinase. Placement of a RARE on the proenkephalin promoter increased NUDR-dependent activation to 41-fold, but this RARE-dependent increase was not transferable to a thymidine kinase promoter. Recombinant NUDR protein showed minimal binding affinity for proenkephalin promoter sequences, but was able to select DNA sequences from a random oligonucleotide library that had similar core-binding motifs (TTCG) as those recognized by DEAF-1. This motif is also present between the half-sites of several endogenous RAREs. The derived consensus- binding motif recognized by NUDR (TTCGGGNNTTTCCGG) was confirmed by mobility shift and deoxyribonuclease I (DNase I) protection assays; however, the consensus sequence was also unable to confer NUDR-dependent transcriptional activation to the thymidine kinase promoter. Our data suggests that NUDR may activate transcription independently of promoter binding, perhaps through protein-protein interaction with basal transcription factors, or by activation of secondary factors. The sequence and functional similarities between NUDR and DEAF-1 suggest that NUDR may also act as a cofactor to regulate the transcription of genes during fetal development or differentiation of testicular cells.
...
PMID:Characterization of a nuclear deformed epidermal autoregulatory factor-1 (DEAF-1)-related (NUDR) transcriptional regulator protein. 977 84

The steroidogenic enzyme P450c17 (17alpha hydroxylase/C17,20 lyase) regulates a key branchpoint in steroidogenesis, as its activity directs the steroid biosynthetic pathways toward glucocorticoid or sex hormone synthesis. Expression of the P450c17 gene is transcriptionally regulated in steroidogenic tissues by cAMP. We showed that DNA between -84 and -55 in the rat P450c17 gene was bound uniquely by steroidogenic factor-1 (SF-1), which regulated both basal and cAMP-stimulated transcription in mouse adrenocortical and Leydig cells. SF-1 gene ablation experiments in mice indicate that SF-1 is not mandatory for placental steroidogenesis. We studied P450c17 gene regulation in the placenta using human placental JEG-3 trophoblast cells. Transfection of reporter luciferase gene constructs containing serial deletions of the 5' flanking region of the rat P450c17 gene showed that DNA between -98 and +13 mediated basal and cAMP-regulated transcription in placental JEG-3 cells, as it did in adrenal and Leydig cells. DNase footprints further identified a region between -88 and the TATA box that was bound by protein. Transfection of luciferase reporter constructs containing -84 to -55 of the rat P450c17 DNA ligated to the minimal promoter of the thymidine kinase gene showed that this DNA increased both basal and cAMP-simulated luciferase activity. Gel mobility shift assays identified two DNA-protein complexes with JEG-3 cell nuclear extracts that were different from complexes formed with MA-10 cell extracts and did not involve SF-1. Mutational analysis of the -84/-55 DNA showed that JEG-3 nuclear proteins bound to a site containing, but not identical to, the SF-1 sequence. One complex involved Ku autoimmune antigen, which bound to DNA sequence specifically. Overexpression of Ku antigen in MA-10 cells stimulated rat P450c17 gene transcription, thus demonstrating a biologic effect of Ku. Ku also bound to a similar region of the human P450c17 gene, and the DNA region to which Ku bound was transcriptionally active in JEG-3 cells. Ku was also found in extracts from rat placenta and bound to the -84/-55 rat P450c17 DNA. These data demonstrate a role of Ku in regulating P450c17 gene expression. These data further indicate that although human P450c17 is not normally expressed in the placenta, factors that could activate this gene are indeed present.
...
PMID:Ku autoimmune antigen is involved in placental regulation of rat P450c17 gene transcription. 1009 1

To analyze the difference in the degree of divergence between genes from identical herpesvirus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-1) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shutoff (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpesvirus TK genes, we compared the diversity of TK genes among eight HSV-1, six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-1 strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of nonsynonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-1 TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-1 in a short period.
...
PMID:Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus. 1035 47

Diverse pro-inflammatory mediators regulate transcription of the gene (MnSOD) encoding the mitochondrial anti-oxidant protein manganese-superoxide dismutase. Understanding the regulation of this gene is crucial to comprehending its role in cytoprotection. In transfected lung epithelial cells, a human-growth-hormone reporter gene system was utilized to identify a potential enhancer in the MnSOD genomic fragment previously shown to contain multiple DNase-I-hypersensitive sites. Northern analysis demonstrated a 10-20-fold increase in response to pro-inflammatory mediators. Inclusion of the MnSOD genomic fragment in reporter constructs was necessary to mimic these stimulus-dependent endogenous levels. The inducible enhancer element was localized to a 260 bp fragment in intron 2, coinciding with a previously defined DNase-I-hypersensitive site. This element functions in an orientation- and position-independent manner as well as with the heterologous thymidine kinase promoter. In addition, we have demonstrated that a homologous sequence within the human MnSOD gene exhibits identical enhancer activity. A novel characteristic of the rat and human enhancer elements involves the ability to promote cytokine-inducible transcription in the absence of a classical promoter.
...
PMID:Cytokine-inducible enhancer with promoter activity in both the rat and human manganese-superoxide dismutase genes. 1072 24

The nucleotide sequence of the human glycoprotein hormone alpha-subunit (GPHalpha) gene 5'-flanking DNA was determined from -1637 to +49 relative to the cap site (+1). Comparison of the upstream sequence of the human gene with those of rhesus and mouse demonstrates regions with variable identity. When the 1.7 kb fragment was used to drive the expression of chloramphenicol acetyltransferase (CAT) in transiently transfected HeLa cells, it was found that CAT activity was elevated about 3-fold when the fragment was truncated from -1637 to -846, suggesting the presence of a negative regulatory element in the distal 5'-flanking DNA. This overlaps an Alu repetitive sequence (ARS) located between nucleotides -1330 and -1007. Gel mobility shift and DNase protection analyses identified a protein binding site centered around -1100 in the ARS second monomer. The GPHalpha upstream ARS was cloned in both orientations in positions upstream and downstream from the bacterial CAT gene under control of the herpes simplex virus thymidine kinase (tk) promoter. DNA-mediated transient transfection of these plasmids revealed a marked inhibition (79-82%) of CAT production by the ARS when it was cloned upstream from the tk promoter and in the same orientation as that found in the GPHalpha 5'-flanking DNA. Smaller decreases (29-57%) were produced by the ARS cloned upstream from the tk promoter in the reverse orientation. In marked contrast, the Alu repetitive element had little or no effect when cloned in either orientation downstream from the tk-CAT gene. Introduction of a second ARS downstream from the CAT reporter gene in vectors already containing an ARS upstream from the tk promoter significantly reduced the strong negative effect elicited by the upstream repetitive element. When compared to the Blur 8 Alu element, the GPHalpha upstream ARS differs markedly with respect to its effect on tk-CAT expression in transient assays and as a substrate for DNA binding proteins present in HeLa nuclear extracts. Together, the transient expression results demonstrate that ARS elements can influence expression of nearby class II promoters. The extent of this effect depends on element position and orientation, cell type, the particular ARS (e.g., GPHalpha or Blur 8), and whether copies were present both upstream and downstream from the transcription unit.
...
PMID:Sequence analysis of the human glycoprotein hormone alpha-subunit gene 5'-flanking DNA and identification of a potential regulatory element as an alu repetitive sequence. 1101 55

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97


<< Previous 1 2 3 4 5 Next >>

---