Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.7.7 (
DNA polymerase
)
17,007
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
The ability of tryptophan tRNA (tRNATrp) to initiate reverse transcription of the 70S RNA of avian RNA tumor viruses suggested that the reverse transcriptase (RNA-dependent DNA polymerase; deoxynucleosidetriphosphate: DNA
deoxynucleotidyltransferase
;
EC 2.7.7.7
) might have a specific binding site for the tRNA. A complex of tRNATrp and the avian myeloblastosis virus reverse transcriptase has been demonstrated using chromatography on Sephadex G-100 columns. Of all the chicken tRNAs, only tRNATrp and a tRNA4Met bind to the enzyme with high enough affinity to be selected from a mixture of the chicken cell tRNAs. The ability of tRNATrp to change the sedimentation rate of the enzyme indicates that tRNATrp is not binding to a contaminant in the enzyme preparation. Treatment of the enzyme with monospecific antibody to reverse transcriptase prevented binding of tRNA as well as inhibited the
DNA polymerase
activity of the enzyme. The ability of reverse transcriptase to utilize tRNATrp aa a primer for DNA synthesis, therefore, appears to involve a highly specific site on the enzyme.
...
PMID:Specific binding of tryptophan transfer RNA to avian myeloblastosis virus RNA-dependent DNA polymerase (reverse transcriptase). 5 56
A fibroblast-like cell culture was established from a stomach biopsy of a patient with metastatic adenocarcinoma. One of the cultures, at the 6th passage level, left unattended for a month at 37 degrees, produced numerous foci of epithelioid cells. Upon subculturing, an epithelioid cell line, designated HCCL (human carcinoma cell line), was established. The HCCL cells released particles possessing the characteristics of oncornaviruses: density 1.175 g/ml, cores with a density of 1.22-1.26 g/ml, high-molecular-weight RNA (60-70S) and RNA-instructed DNA polymerase activity (deoxynucleosidetriphosphate:DNA
deoxynucleotidyltransferase
,
EC 2.7.7.7
). Inoculation of particles released from HCCL cells into cultures of human embryo muscle fibroblasts resulted in the appearance of foci of transformed cells.
...
PMID:Transformation of cultured human embryonic fibroblasts by oncornavirus-like particles released from a human carcinoma cell line. 5 57
The RNA-directed DNA polymerase (deoxynucleosidetriphosphate:DNA
deoxynucleotidyltransferase
EC 2.7.7.7
) of avian oncornavirus requires a tryptophan tRNA (tRNATrp) primer molecule located close to the 5' end of the viral RNA genome for the initiation of DNA synthesis in vitro. In this communication we demonstrate that the DNA product, transcribed from avian myeloblastosis virus (AMV) 35S RNA containing only tRNATrp as primer, is located also at the 5' end of the RNA genome. More importantly, we demonstrate that these 5' terminal DNA transcripts contain nucleotide sequences complementary to the 3' end of the genome. We have interpreted these results to mean that the genome. We have interpreted these results to mean that the 3' and 5' termini of the AMV 35S RNA genome become juxtaposed with each other either before or immediately after DNA synthesis has begun. These results are discussed in regard to the mechanism for synthesis of the circular forms of oncornavirus proviral DNA.
...
PMID:Evidence for circularization of the avian oncornavirus RNA genome during proviral DNA synthesis from studies of reverse transcription in vitro. 5 20
Cocultivation of cells derived from embryos of golden pheasants or Amherst pheasants with chicken embryo cells infected with Bryan strain of Rous sarcoma virus resulted in the detection of viruses which appear to be endogenous in these pheasant cells. The pheasant viruses (PV) were similar to avian leukosis-sarcoma viruses (ALSV) in their gross morphology, in the size of their RNA, in the presence of a virion-associated RNA-dependent DNA polymerase (
DNA nucleotidyltransferase
; deoxynucleoside triphosphate: DNA
deoxynucleotidyltransferase
;
EC 2.7.7.7
), and in their growth characteristics. PV also serves as a helper for the glycoprotein-defective Rous sarcoma virus. However, PV was shown to be different from both ALSV and reticuloendotheliosis virus in the following properties: (i) PV does not have ALSV group specific antigens; (ii) the protein composition of PV is different from those of the other two groups of viruses; (iii) PV fails to complement the defective polymerase of alpha type Rous sarcoma virus; and (iv) PV RNA shows no detectable homology with nucleic acids of the other two groups of viruses. Thus, PV appears to be a new class of RNA viruses which contain RNA-dependent DNA polymerase.
...
PMID:Pheasant virus: new class of ribodeoxyvirus. 5 21
Two approaches have been explored for the synthesis of double-stranded DNA from single-stranded DNA template complementary to rabbit 9S globin mRNA (cDNA). (i) cDNA was elongated with dCMP or dTMP homopolymeric tracts using terminal deoxynucleotidyltransferase (EC 2.7.7.31; nucleosidetriphosphate:DNA deoxynucleotidylexotransferase). cDNA-dC, in the presence of an oligo(dG)10 primer, was an efficient template with either
DNA polymerase
of Escherichia coli (
EC 2.7.7.7
; deoxynucleosidetriphosphate:DNA
deoxynucleotidyltransferase
) or RNA-directed DNA polymerase of avian myeloblastosis virus. cDNA-dT [ with an oligo(dA)10 primer] functioned as template only with E. coli polymerase. (ii) cDNA, without homopolymeric tails, was also efficiently copied in the absence of oligonucleotide primer, by
DNA polymerase
of avian myeloblastosis virus or of E. coli. The product of the reaction consisted of long hairpin molecules which could be converted into DNA duplex (melting temperature, 93 degrees) by digestion with single-strand nuclease S1. The data indicate that a loop structure on the 3' end of cDNA allowed DNA synthesis to take place by a "self-priming" mechanism. Some of the double-stranded DNA synthesized corresponded to the entire sequence of the 9S mRNA template. The synthesis of full-length double-stranded DNA from mouse globin mRNA and immunoglobulin light chain mRNA is also discussed.
...
PMID:Stepwise biosynthesis in vitro of globin genes from globin mRNA by DNA polymerase of avian myeloblastosis virus. 6 60
A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA
deoxynucleotidyltransferase
,
EC 2.7.7.7
) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84
The initiation of DNA synthesis in vitro by RNA-directed DNA polymerase (deoxynucleosidetriphosphate: DNA
deoxynucleotidyltransferase
,
EC 2.7.7.7
) of avian oncornaviruses requires a tRNAtrp primer molecule located close to the 5' end of the viral RNA genome. DNA transcripts, 100 nucleotides in length, initiated on the tRNAtrp primer molecule contain nucleotide sequences complementary to a large (25 nucleotides) RNase T1 oligonucleotide, T-13, located at the 5' terminus of the avian sarcoma virus RNA genome. tRNAtrp-initiated DNA transcripts with a length of about 70 nucleotides contain substantially fewer nucleotide sequences complementary to this 5'-terminal oligonucleotide, suggesting that the tRNAtrp primer associated with the avian sarcoma virus RNA is located approximately 100 nucleotides from the 5' end of the RNA. In addition, we present evidence to demonstrate that DNA transcribed from avian sarcoma virus RNA sequences located at the 3' end, immediately adjacent to the poly(A), contains nucleotide sequences that are complementary to the 5'-terminal T1 oligonucleotide T-13. These data indicate that the 5' end of the viral genome contains nucleotide sequences that are repeated at the 3' end of the genome. We conclude that the avian oncornavirus RNA genome is terminally redundant.
...
PMID:Terminally repeated sequences in the avian sarcoma virus RNA genome. 7 37
A restriction fragment strand complementary to a sequence near the 3' end of Escherichia coli 16S rRNA has been used to prime reverse transcriptase (avian myeloblastosis virus RNA-directed
DNA nucleotidyltransferase
; deoxynucleosidetriphosphate:DNA
deoxynucleotidyltransferase
,
EC 2.7.7.7
). In addition to transcripts that were extended to the 5' end of the RNA, two major transcription intermediates were observed. These discrete-sized cDNA intermediates are the result of a kinetic barrier imposed by monomethylation of the amino group on guanine that participates in base-pairing. Both major transcription intermediates correspond to attenuation at the known positions of N2-methylguanine (m2G) in the rRNA sequence. The relaxation time for elongation of the cDNA through m2G is approximately 3 min. No other major kinetic pauses were observed in the 1340 bases transcribed.
...
PMID:Reverse transcriptase pauses at N2-methylguanine during in vitro transcription of Escherichia coli 16S ribosomal RNA. 9 Nov 69
alpha and beta DNA polymerases (
DNA nucleotidyltransferase
; deoxynucleosidetriphosphate:DNA
deoxynucleotidyltransferase
,
EC 2.7.7.7
) were isolated from nuclear and cytoplasmic fractions of rat livers exposed to a carcinogenic regimen with the hepatocarcinogen N-2-fluorenylacetamide and from 24-hr regenerating liver. The fidelity of polymerization of these enzymes was compared by determining the incorporation of noncomplementary deoxyribonucleoside triphosphates (misincorporation) on a poly(dA-dT).poly(dA-dT) template, with MnCl2 and MgCl2 as divalent cations. Our initial studies indicate that the cytoplasmic alpha polymerases from carcinogen-exposed rat livers were strikingly error-prone whereas the nuclear and cytoplasmic beta polymerases retained their fidelity throughout the feeding cycles. The misincorporation was significantly accentuated by MnCl2 compared with that obtained with MgCl2 as divalent cation. The products were sensitive to pancreatic DNase I digestion, indicating that the noncomplementary bases had been incorporated by the polymerization process. Nuclear alpha polymerase showed some degree of infidelity but less than that of cytoplasmic alpha polymerase.
...
PMID:Decreased fidelity of DNA polymerase activity during N-2-fluorenylacetamide hepatocarcinogenesis. 28 2
The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA
deoxynucleotidyltransferase
,
EC 2.7.7.7
) beta and gamma were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. UV irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to
DNA polymerase beta
which, at this developmental stage, is virtually the only
DNA polymerase
present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this way probably due to the inability of brain tissues to excise alkylated bases from DNA. The role of
DNA polymerase gamma
was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that, under these conditions, DNA replication occurs in mitochondria, and exploiting the fact that
DNA polymerase
gama is the only
DNA polymerase
present in mitochondria, evidence was obtained for a role of
DNA polymerase gamma
in mitochondrial DNA replication. Based on these results and on the wealth of literature on
DNA polymerase alpha
, we conclude that
DNA polymerase alpha
is mainly responsible for DNA replication in nuclei,
DNA polymerase beta
is involved in nuclear DNA repair, and
DNA polymerase gamma
is the mitochondrial replicating enzyme. However, minor roles for
DNA polymerase alpha
in DNA repair or for
DNA polymerase beta
in DNA replication cannot be excluded.
...
PMID:Functional roles of DNA polymerases beta and gamma. 28 74
1
2
3
4
5
Next >>