Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.7.7 (DNA polymerase)
17,007 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Rauscher leukemia virus RNA-directed DNA polymerase has been purified to near homogeneity (greater than 90% pure) using affinity chromatography on polycytidylate-agarose with over 85% recovery of input enzymatic activity. The purified enzyme has a molecular weight of approximately 70,000 and appears to consist of a single polypeptide chain. The enzyme is free of DNase, but has RNase H activity. Analysis of the requirements for optimal rates of DNA synthesis by this enzyme using synthetic and natural template-primers has revealed template-specific variations in such requirements. During these studies it was observed that DNA synthesis catalyzed by Rauscher leukemia virus DNA polymerase is inhibited by the addition of inorganic phosphate. An analysis of the mechanism of phosphate inhibition was carried out using the synthetic template-primer poly(A)-(dT)10. It appears that by some mechanism, possibly involving the substrate binding site of the enzyme, phosphate ions inhibit DNA synthesis with a more acute effect on the rate of chain growth than on that of initiation. The extension of these studies to DNA synthesis catalyzed by a variety of mammalian type C viral reverse transcriptases revealed that low levels ( less than or equal to 2 mM) of inorganic phosphate strongly inhibited DNA synthesis. The susceptibility to phosphate inhibition appears unique to mammalian type C viral enzymes since the type B viral enzyme, Escherichia coli DNA polymerase I, avian myeloblastosis virus and Mason Pfizer monkey tumor virus reverse transcriptase and cellular DNA polymerases alpha and gamma are not inhibited by inorganic phosphate. This phenomenon of phosphate inhibition of various DNA polymerases, therefore, provides a new basis for the differentiation of the sources and nature of these enzymes.
...
PMID:Purification and properties of Rauscher leukemia virus DNA polymerase and selective inhibition of mammalian viral reverse transcriptase by inorganic phosphate. 6 68

The activities of streptovaricin complexes, streptovaricins, streptovals, and streptovarinic degradation products were elevated against RNA-directed DNA polymerases of Rauscher leukemia virus, DNA-dependent DNA polymerase of bacterial and mammalian cells, and DNA-dependent RNA polymerases of mammalian origin. The activities of streptovaricins were also listed for comparison purposes. The effects of streptovaricin complexes on viral DNA polymerases varied significantly from lot to lot, and streptovaricin complex lot 7 was the most active. All the streptovals and streptovaricin degradation products except varicinal A showed a marked improvement (twofold to tenfold) in activity against the viral enzyme over the parent streptovaricins. None of these compounds, however, displayed any significant effect on either the DNA polymerase of L1210 leukemia cells and Escherichia coli or the RNA polymerase of isolated nuclei of mouse liver. As a result of tests in these systems, some specific inhibitors of RNA-directed DNA polymerases of Rauscher leukemia virus were selected.
...
PMID:Effects of streptovaricins and their degradation products on RNA-directed DNA polymerase of Rauscher leukemia virus. 6 15

DNA, complementary to chicken globin mRNA was synthesized using either Avian Myeloblastosis virus reverse transcriptase, or E. coli DNA polymerase I. Transcriptase cDNA sediments at 9 S on sucrose gradients, and is 620 nucleotides in length, representing a complete copy of globin mRNA template. In contrast, Polymerase I cDNA sediments at 4 S, is 100 to 200 nucleotides in length, and is a copy of a small region at the 3'(poly A) end of globin mRNA. Similarly, Transcriptase cDNA and Polymerase I cDNA hybridize to globin mRNA template with characteristic, individual Crot1/2 values. The Crot1/2 value for Transcriptase cDNA hybridization is 7 X 10(-4) mol s 1(-1), and that for Polymerase I cDNA is 5 X 10(-3). This work shows that Avian Myeloblastosis virus reverse transcriptase can use Polymerase I cDNA to prime further cDNA synthesis along the mRNA template. The product of extended cDNA synthesis is identical in length and hybridization properties to oligo (dT) primed transcriptase cDNA.
...
PMID:Gene specific priming of complementary DNA synthesis. 6 22

Cytoplasmic RNA extracted from antigen stimulated immunocompetant cells is transcribed in vitro into DNA by the RNA directed DNA polymerase from avian myeloblastosis virus, in the absence of any added primer. Cytoplasmic RNA from other organs of the same animal, from non-stimulated immunocompetent cells, or from cells in tissue culture is not transcribed in the absence of exogenous primer.
...
PMID:[Presence in immunostimulated cells of an RNA molecule utilizable as template for reverse transcriptase of avian myeloblastosis virus (AMV)]. 6 33

Fractionation of purified avian myeloblastosis virus DNA polymerase, after phosphorylation in vitro, revealed the presence of a small acidic proten, a phosphate acceptor polypeptide with high specific activity. Its presence in the phosphorylated form with the polymerase resulted in as much as a 10-fold increase in the rate of DNA synthesis. Its presence in the dephosphorylated form with the polymerase had no effect in the rate of DNA synthesis.
...
PMID:Chemical modification of DNA polymerase phosphoprotein from avian myeloblastosis virus. 6 34

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84

These studies were designed to determine if RIDP was present in a particulate fraction of brains from patients with ALS and PD. Evidence that we have detected RIDP is as follows: (a) DNA polymerase activity persists in the presence of concentrations of actinomycin D and distamycin that inhibit most DNA-directed DNA synthesis (25); (b) the majority of endogenous DNA polymerase activity is sensitive to prior treatment with RNase; (c) the early reaction product is a 4-5 S DNA heteropolymer joined by hydrogen bonds to an RNA molecule; and (d) the purified [3H]DNA product anneals to RNA extracted from the enzyme-containing pellet more extensively than to normal brain RNA or poly(rA). The enzyme activity is in a cytoplasmic particle that can be sedimented at high speed and has the buoyant density of RNA tumor viruses (1.16-1.18 gm/ml). This particulate fraction is not disrupted by physical manipulation and maintains its characteristic density with repeated centrifugations. Treatment with the nonionic surfactant Sterox changes the buoyant density of the enzyme-containing particle to 1.24 gm/ml, the density of the onconavirus virion core. Synthesis of RNA-DNA hybrids by an endogenous reverse transcriptase reaction was found only in normal and diseased Chamorro brains. Examination of a limited number of normal and diseased brains from individuals who lived in the United States produced negative results (39). Definitive characterization of this polymerase activity and identification as a true viral polymerase will depend on purification of biochemically active quantities of this polymerase to determine its template specificities, its cation preference, the fidelity of its transcription product, as well as its antigenic relationship to animal virus and human leukemic RIDP. Of critical importance in these studies will be differentiation of this activity from normal brain DNA polymerase gamma and terminal deoxynucleotidyltransferase.
...
PMID:RNA tumor viruses as causative agents of chronic neurological disease. 6 87

Based on the observation that in vitro transcription of Rous sarcoma virus (RSV) RNA by avian myeloblastosis virus DNA polymerase renders the RNA PROGRESSIVELY MORE SENSITIVE TO Escherichia coli RNase H digestion, a new procedure for the in situ analysis of this process has been developed. In vitro transcription products of 32P-labeled RSV RNA are first treated with RNase H, the resistant fraction is then digested to completion with RNase T1, and the oligonucleotides are analyzed by a fingerprint technique. By using the established order of these oligonucleotides along the RNA molecule, a comparison of the yields of each oligonucleotide, before and after transcription, allows qualitative and quantitative in situ analyses of the transcription process. Using this new procedure, we find that upon transcription of purified RSV RNA, DNA synthesis occurs mainly at three sites, one near the 5' end and two near the center of the subunit RNA molecule, and that most of these RNA molecules are competent templates for limited transcription at these specific sites. We also show that purified RSV 70S RNA contains a low-molecular-weight DNA hybridized to a nucleotide sequence near the center of the subunit molecule. Furthermore , we find that the low-molecular-weight nucleic acid fraction extracted from purified RSV virions contains DNA that can hybridize to RSV 70S RNA and that the virion DNA in such hybrids can function as a primer for an extensive in vitro reverse transcription.
...
PMID:New procedure for the direct analysis of in vitro reverse transcription of Rous sarcoma virus RNA. 6 18

Equine infectious anemia (EIAV) is shown to have an associated RNA-instructed DNA polymerase similar in its cofactor requirements and reaction conditions to the RNA tumor virus DNA polymerases. Demonstrating this DNA polymerase activity requires a critical concentration of a nonionic detergent, all four deoxyribonucleoside triphosphates, and a divalent metal ion. The reaction is sensitive to RNase, and a substantial fraction of the FNA synthesized is complementary to viral RNA. The detection of a complex of tritium-labeled polymerase product DNA-template RNA, which sedimented at 60S to 70S, provided evidence that EIAV contains high-molecular-weight RNA. These results, obtained with both virus propagated in cell culture and virus from the serum of an experimentally infected horse, indicate that EIAV may properly be considered a member of the family Retroviridae. They may also be pertinent to the mechanism(s) of viral persistence and periodic recrudescence of disease in chronically infected horses.
...
PMID:RNA-dependent DNA polymerase associated with equine infectious anemia virus. 6 19

The RNase H activity associated with several RNA-directed DNA polymerases is inhibited by the addition of DNA, in contrast to RNase H activity from enzymes devoid of polymerizing activity. Kinetic investigations of the inhibitory effect of DNA, using purified Rauscher leukemia virus DNA polymerase as a test enzyme, revealed that the addition of DNA to an ongoing RNase H reaction causes an immediate cessation of RNase H activity. Concomitant initiation of DNA synthesis by inhibitory DNA can occur, provided that appropriate substrate and primer is available. Thus, in addition to providing a simple test for the distinction between polymerase-associated and polymerase-independent RNase H activity, this study strongly supports the concepts that (i) RNase H activity expressed by several mammalian oncoviral reverse transcriptases is an integral part of that molecule, and (ii) that the catalytic site of RNase H activity is also involuved in template-primer binding.
...
PMID:Specific inhibition of DNA polymerase-associated RNase H by DNA. 6 22


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>