Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.7.7 (
DNA polymerase
)
17,007
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Synthesis of alpha-polymerase in translation mixtures containing calf thymus poly(A+) RNA was examined by activity gel analysis and by immuno-binding with a monoclonal antibody to calf thymus alpha-polymerase. Activity gel analysis indicated that a
DNA polymerase
catalytic polypeptide of Mr = approximately 120,000 had been synthesized. Immunobinding experiments indicated that an immunoreactive polypeptide of about the same size had been formed in vitro.
Sucrose
gradient centrifugation of calf thymus total RNA revealed that mRNA encoding the approximately 120,000-Mr
DNA polymerase
polypeptide sedimented at about 16S. This approximately 120,000-Mr catalytic polypeptide corresponds in size to an alpha-polymerase catalytic polypeptide found earlier in crude extracts of calf cells.
...
PMID:Synthesis of DNA polymerase by in vitro translation of calf RNA. 674 42
DNA polymerases must select nucleotides that preserve Watson-Crick base pairing rules and choose substrates with the correct (deoxyribose) sugar.
Sugar
discrimination represents a great challenge because ribonucleotide triphosphates are present at much higher cellular concentrations than their deoxy-counterparts. Although DNA polymerases discriminate against ribonucleotides, many therapeutic nucleotide analogs that target polymerases have sugar modifications, and their efficacy depends on their ability to be incorporated into DNA. Here, we investigate the ability of
DNA polymerase beta
to utilize nucleotides with modified sugars.
DNA polymerase beta
readily inserts dideoxynucleoside triphosphates but inserts ribonucleotides nearly 4 orders of magnitude less efficiently than natural deoxynucleotides. The efficiency of ribonucleotide insertion is similar to that reported for other DNA polymerases. The poor polymerase-dependent insertion represents a key step in discriminating against ribonucleotides because, once inserted, a ribonucleotide is easily extended. Likewise, a templating ribonucleotide has little effect on insertion efficiency or fidelity. In contrast to insertion and extension of a ribonucleotide, the chemotherapeutic drug arabinofuranosylcytosine triphosphate is efficiently inserted but poorly extended. These results suggest that the sugar pucker at the primer terminus plays a crucial role in DNA synthesis; a 3'-endo sugar pucker facilitates nucleotide insertion, whereas a 2'-endo conformation inhibits insertion.
...
PMID:DNA polymerase beta ribonucleotide discrimination: insertion, misinsertion, extension, and coding. 2051 99
The experimental host range of Maize chlorotic mottle virus (MCMV) is restricted to the Gramineae (Poaceae) family with maize as a natural host. However, MCMV has never been found to infect sugarcane (
Saccharum
officinarum L.) plants in fields. MCMV can cause corn lethal necrosis disease (CLND) resulting from synergistic interaction between this virus and Maize dwarf mosaic virus (MDMV), Wheat streak mosaic virus (WSMV), or Sugarcane mosaic virus (SCMV) (1). MCMV was first found on maize plants in Yunnan Province in China in 2011 (2), and co-infection of MCMV and SCMV was reported on maize in Yunnan Province in China in 2013 (1). In January 2013, while surveying MCMV on maize in Yunnan Province, we found sugarcane planted near an MCMV-infected maize field with chlorotic and mosaic viral symptoms. Five symptomatic sugarcane plants were collected and screened for MCMV using a monoclonal antibody-based dot-ELISA (1). MCMV was detected in all five sugarcane samples using this assay. To further confirm the ELISA results, total RNA was isolated from sugarcane leaves using TRIzol reagent (Invitrogen, Carlsbad, CA) and assayed for MCMV by reverse transcription (RT)-PCR with primers M69F (ACAGGACACCGTTGCCGTTTAT) and M70R (CATGGGTGGGTCAAGGCTTACT) designed to amplify nt 3301 to 4282 of MCMV maize isolate YN2 (GenBank Accession No. JQ982468). The expected 982-bp amplicon was obtained from all five sugarcane samples confirming that the five sugarcane samples were infected with MCMV. Using purified total RNA as a template, RT-PCR was performed using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA) and Pfusion High-Fidelity
DNA polymerase
(New England Biolabs, Ipswich, MA) with primers M10 (AGGTAATCTGCGGCAACAGACC, 1 to 22 nt) and M36 (GGGCCGGAAGAGAGGGGCATTAC, 4436 to 4414 nt). The sequence of the resulting cDNA amplicon (KF010583) indicated that the MCMV sugarcane isolate shares 99% sequence identity with the MCMV maize isolate YN2 from Yunnan Province in China. Attempts to mechanically transmit MCMV from sugarcane to maize were unsuccessful. However, quantitative real time RT-PCR result revealed that the virus titer in sugarcane plants was about 6 to 10 times lower than that in maize plants (data not shown). SCMV was also detected in the five MCMV-infected sugarcane samples by RT-PCR with primers W48F (GTGTGGAATGGTTCACTCAAAGCTG) and W49R (GGTGTTGCAATTGGTGTGTACACG), designed to amplify a 395-bp fragment of the SCMV Beijing isolate (AY042184). The sequence of the amplified products shared 98% identity with SCMV isolate JP2 (JF488065). Thus, we think chlorotic and mosaic symptoms on the sugarcane plant samples were caused by co-infection of MCMV and SCMV and the sugarcane plants harbor both viruses implicated in causing maize lethal necrosis. This study indicates that MCMV naturally infects sugarcane plants. To our knowledge, this is the first report of MCMV infecting sugarcane plants. References: (1) J.-X. Wu et al. J. Zhejiang Univ-Sci B (Biomed & Biotechnol). 14:555, 2013. (2) L. Xie et al. J. Phytopathol. 159:191, 2011.
...
PMID:First Report of Maize chlorotic mottle virus Infecting Sugarcane (Saccharum officinarum). 3070 16
<< Previous
1
2