Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.7.7 (DNA polymerase)
17,007 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Two approaches have been explored for the synthesis of double-stranded DNA from single-stranded DNA template complementary to rabbit 9S globin mRNA (cDNA). (i) cDNA was elongated with dCMP or dTMP homopolymeric tracts using terminal deoxynucleotidyltransferase (EC 2.7.7.31; nucleosidetriphosphate:DNA deoxynucleotidylexotransferase). cDNA-dC, in the presence of an oligo(dG)10 primer, was an efficient template with either DNA polymerase of Escherichia coli (EC 2.7.7.7; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase) or RNA-directed DNA polymerase of avian myeloblastosis virus. cDNA-dT [ with an oligo(dA)10 primer] functioned as template only with E. coli polymerase. (ii) cDNA, without homopolymeric tails, was also efficiently copied in the absence of oligonucleotide primer, by DNA polymerase of avian myeloblastosis virus or of E. coli. The product of the reaction consisted of long hairpin molecules which could be converted into DNA duplex (melting temperature, 93 degrees) by digestion with single-strand nuclease S1. The data indicate that a loop structure on the 3' end of cDNA allowed DNA synthesis to take place by a "self-priming" mechanism. Some of the double-stranded DNA synthesized corresponded to the entire sequence of the 9S mRNA template. The synthesis of full-length double-stranded DNA from mouse globin mRNA and immunoglobulin light chain mRNA is also discussed.
...
PMID:Stepwise biosynthesis in vitro of globin genes from globin mRNA by DNA polymerase of avian myeloblastosis virus. 6 60

An RNA directed DNA polymerase was purified over 2500 fold from gibbon ape leukemia virus by successive column chromatography on Sephadex G100, DEAE cellulose, phosphocellulose and hydroxyapatite. The purified DNA polymerase has a molecular weight of 68 000, a pH optimum of 7.5, a Mn2+ optimum of 0.8 mM, and KCl optimum of 80 mM. The purified enzyme transcribes heteropolymeric regions of viral 60-70 S RNA isolated from avian myeloblastosis virus, Rauscher murine leukemia virus and simian sarcoma virus and it is inhibited by antiserum prepared against either gibbon ape leukemia virus or simian sarcoma virus DNA polymerases.
...
PMID:Purification and characterization of gibbon ape leukemia virus DNA polymerase. 6 92

Rauscher leukemia virus RNA-directed DNA polymerase has been purified to near homogeneity (greater than 90% pure) using affinity chromatography on polycytidylate-agarose with over 85% recovery of input enzymatic activity. The purified enzyme has a molecular weight of approximately 70,000 and appears to consist of a single polypeptide chain. The enzyme is free of DNase, but has RNase H activity. Analysis of the requirements for optimal rates of DNA synthesis by this enzyme using synthetic and natural template-primers has revealed template-specific variations in such requirements. During these studies it was observed that DNA synthesis catalyzed by Rauscher leukemia virus DNA polymerase is inhibited by the addition of inorganic phosphate. An analysis of the mechanism of phosphate inhibition was carried out using the synthetic template-primer poly(A)-(dT)10. It appears that by some mechanism, possibly involving the substrate binding site of the enzyme, phosphate ions inhibit DNA synthesis with a more acute effect on the rate of chain growth than on that of initiation. The extension of these studies to DNA synthesis catalyzed by a variety of mammalian type C viral reverse transcriptases revealed that low levels ( less than or equal to 2 mM) of inorganic phosphate strongly inhibited DNA synthesis. The susceptibility to phosphate inhibition appears unique to mammalian type C viral enzymes since the type B viral enzyme, Escherichia coli DNA polymerase I, avian myeloblastosis virus and Mason Pfizer monkey tumor virus reverse transcriptase and cellular DNA polymerases alpha and gamma are not inhibited by inorganic phosphate. This phenomenon of phosphate inhibition of various DNA polymerases, therefore, provides a new basis for the differentiation of the sources and nature of these enzymes.
...
PMID:Purification and properties of Rauscher leukemia virus DNA polymerase and selective inhibition of mammalian viral reverse transcriptase by inorganic phosphate. 6 68

Cytoplasmic RNA extracted from antigen stimulated immunocompetant cells is transcribed in vitro into DNA by the RNA directed DNA polymerase from avian myeloblastosis virus, in the absence of any added primer. Cytoplasmic RNA from other organs of the same animal, from non-stimulated immunocompetent cells, or from cells in tissue culture is not transcribed in the absence of exogenous primer.
...
PMID:[Presence in immunostimulated cells of an RNA molecule utilizable as template for reverse transcriptase of avian myeloblastosis virus (AMV)]. 6 33

Fractionation of purified avian myeloblastosis virus DNA polymerase, after phosphorylation in vitro, revealed the presence of a small acidic proten, a phosphate acceptor polypeptide with high specific activity. Its presence in the phosphorylated form with the polymerase resulted in as much as a 10-fold increase in the rate of DNA synthesis. Its presence in the dephosphorylated form with the polymerase had no effect in the rate of DNA synthesis.
...
PMID:Chemical modification of DNA polymerase phosphoprotein from avian myeloblastosis virus. 6 34

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84

Based on the observation that in vitro transcription of Rous sarcoma virus (RSV) RNA by avian myeloblastosis virus DNA polymerase renders the RNA PROGRESSIVELY MORE SENSITIVE TO Escherichia coli RNase H digestion, a new procedure for the in situ analysis of this process has been developed. In vitro transcription products of 32P-labeled RSV RNA are first treated with RNase H, the resistant fraction is then digested to completion with RNase T1, and the oligonucleotides are analyzed by a fingerprint technique. By using the established order of these oligonucleotides along the RNA molecule, a comparison of the yields of each oligonucleotide, before and after transcription, allows qualitative and quantitative in situ analyses of the transcription process. Using this new procedure, we find that upon transcription of purified RSV RNA, DNA synthesis occurs mainly at three sites, one near the 5' end and two near the center of the subunit RNA molecule, and that most of these RNA molecules are competent templates for limited transcription at these specific sites. We also show that purified RSV 70S RNA contains a low-molecular-weight DNA hybridized to a nucleotide sequence near the center of the subunit molecule. Furthermore , we find that the low-molecular-weight nucleic acid fraction extracted from purified RSV virions contains DNA that can hybridize to RSV 70S RNA and that the virion DNA in such hybrids can function as a primer for an extensive in vitro reverse transcription.
...
PMID:New procedure for the direct analysis of in vitro reverse transcription of Rous sarcoma virus RNA. 6 18

The primary structures for tTNATrp (bovine) and primer tRNATrp (avian) show only minor differences in nucleotide sequence. The heterologous tRNATrp (bovine) appears to have properties similar to the tRNATrp (avian) in its ability to bind the alphabeta from of RNA-dependent DNA nucleotidyltransferase of avian myeloblastosis virus. A stable enzyme-tRNA complex has been isolated by gel filtration. In addition, tRNATrp (bovine) can hydridize to the avian viral 35S RNA and act as a primer for transcription of the RNA. tRNATrp (bovine) can be obtained in larger amounts than the avian primer and can be used to study the interactions between the primer and the viral enzyme.
...
PMID:tRNATrp (bovine) binding to the reverse transcriptase of avian myeloblastosis virus and function as a heterologous primer. 6 71

Northern poke lymphosarcoma DNA polymerase was partially purified from particulate fractions banding at 1.15 to 1.16 g/ml from homogenates prepared from frozen necropsies of tumor-bearing pike. The enzyme behaves as a typical reverse transcriptase, in that it prefers ribotemplates to deoxytemplates. The isoelectric point (pl 5.5) is similar to that of avian myeloblastosis virus polymerase. The pike enzyme elutes from a phosphocellulose column at 0.22 M potassium phosphate, the same as avian myeloblastosis virus DNA polymerase. The enzyme activity is inhibited by pyran, a specific inhibitor of viral DNA polymerases. The most striking difference between the pike lymphoma polymerase and the other viral DNA polymerases tested is the low maximum temperature of 20 degrees, compared to 30 degrees for Rauscher leukemia virus polymerase and 38 degrees for avian myeloblastosis virus and Rous sarcoma virus.
...
PMID:Presence of DNA polymerase in lymphosarcoma in northern pike (Esox lucius). 6 92

Conditions are described that promote the efficient reverse transcription of most of Rous sarcoma virus (RSV) RNA sequences by avian myeloblastosis virus DNA polymerase in vitro. A detailed analysis of the reverse transcription reaction was carried out using two procedures: in situ analysis of the RNA sequences transcribed and DNA-RNA annealing studies. Under optimal conditions, after 1 h of reaction, practically all RSV RNA sequences were transcribed with a frequency varying from 30 to 90%. The DNA product was at least 95% single stranded, had a chain length ranging from a few hundred up to 5,000 necleotide residues, half of it being larger than 1,000 residues, and, after hybridization at RNA excess, protected the entire RSV genome from RNase digestion, as monitored by the large T1 oligonucleotides of RSV RNA. Analysis of the product of a very short reaction time (5 min) showed that DNA synthesis occurs mainly at three sites, one near the 5' end and two near the center of the subunit RNA. This in in agreement with our previous analysis of a much less efficient reverse transcription reaction. Under optimal conditions of reverse transcription, we find now that the RNase H associated with the avian myeloblastosis virus DNA polymerase is active in degrading the RNA moiety of the RNA-DNA hybrids synthesized.
...
PMID:Extensive in vitro transcription of rous sarcoma virus RNA by avian myeloblastosis virus DNA polymerase and concurrent activation of the associated RNase H. 7 May 39


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>