Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.7.7 (DNA polymerase)
17,007 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

A preliminary analysis of an RNA-directed DNA polymerase was made and a C-type virus-like particle was identified in platelets from 2 patients with the myeloproliferative disorder thrombocythemia (primary, essential, hemorrhagic, or idiopathic thrombocythemia). Platelet homogenates were centrifuged through a sucrose equilibrium density gradient. Both endogenous and exogenous DNA polymerase activity was found at a density of 1.19 g/ml. No activity was seen at comparable densities in control gradients. Electron micrographs of thin sections of these platelets revealed a particle with the morphologic characteristics of a C-type virus; however, the diameter of this particle was about 80 nm, slightly lower than that commonly found for C-type particles. Critical-point dried specimens, from the fractions of the sucrose gradient at which DNA polymerase activity was found, contained particles of the same size and morphology as those in the thin sections.
...
PMID:Analysis of platelets from patients with thrombocythemia for reverse transcriptase and virus-like particles. 5 32

The alpha beta DNA polymerase of avian myeloblastosis virus was treated with dimethyl sulfoxide to dissociate the enzyme subunits. The dimethyl sulfoxide treated enzymes were passed over phosphocellulose to purify and characterize the dissociated subunits as well as to remove the dimethyl sulfoxide. RNA-directed DNA polymerase, RNase H, and nucleic acid-binding activity were monitored, as well as the subunit structure (on sodium dodecyl sulfate-polyacrylamide gels) of the various enzyme species obtained. With 30% dimethyl sulfoxide, the majority of DNA polymerase and RNase H activities as well as the alpha subunit were displaced from the alpha beta DNA polymerase position on phosphocellulose (0.23 M potassium phosphate) to the alpha DNA polymerase position (0.1 M). The association of DNA polymerase and RNase H activities with the alpha subunit suggests that alpha is the enzymatically active subunit in alpha beta. In addition to alpha DNA polymerase, a minor polymerase species eluted from phosphocellulose at 0.4 M potassium phosphate. The dissociated beta subunit eluted from phosphocellulose at a wide range of salt concentrations (0.28 to 0.5 M potassium phosphate). The dissociated beta subunit bound 3H-labeled murine leukemia virus RNA and [3H]poly(dT)-poly(dA) approximately 20-fold more avidly than alpha DNA polymerase alone. In contrast to the results with the alpha subunit, there was no correlation between DNA polymerase and RNase H activity profiles and the elution profile of the beta subunit from phosphocellulose. These observations suggest the beta subunit is either enzymatically inactive or possesses limited DNA polymerase and RNase H activity when compared with the alpha subunit.
...
PMID:Dissociation of alpha beta DNA polymerase of avian myeloblastosis virus by dimethyl sulfoxide. 5 61

The RNA-directed DNA polymerase (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase EC 2.7.7.7) of avian oncornavirus requires a tryptophan tRNA (tRNATrp) primer molecule located close to the 5' end of the viral RNA genome for the initiation of DNA synthesis in vitro. In this communication we demonstrate that the DNA product, transcribed from avian myeloblastosis virus (AMV) 35S RNA containing only tRNATrp as primer, is located also at the 5' end of the RNA genome. More importantly, we demonstrate that these 5' terminal DNA transcripts contain nucleotide sequences complementary to the 3' end of the genome. We have interpreted these results to mean that the genome. We have interpreted these results to mean that the 3' and 5' termini of the AMV 35S RNA genome become juxtaposed with each other either before or immediately after DNA synthesis has begun. These results are discussed in regard to the mechanism for synthesis of the circular forms of oncornavirus proviral DNA.
...
PMID:Evidence for circularization of the avian oncornavirus RNA genome during proviral DNA synthesis from studies of reverse transcription in vitro. 5 20

We have compared the relative merits of several procedures for the isolation of RNA-directed DNA polymerase (EC 2.7.7.7.) from cells using a reconsituted model system consisting of a mixture of woolly monkey (simian) sarcoma virus and a cultured human lymphoblastoid cell line, NC-37. When the cell-virus mixture was gently disrupted and fractionated by differential centrifugation, most of the added polymerase was recovered associated with a particulate fraction obtained from the post-mitochondrial supernatant. Purification of the polymerase was best achieved starting from this fraction. The particulate fraction itself can be purified by gel filtration through a Sepharose 2 B column. This procedure did not significantly alter the composition of viral and cellular DNA polymerases. Whereas as little as 7.5 - 10(5) viral particles were sufficient for the detection of RNA-directed DNA polymerase activity, a minimum of about 10(11) particles were necessary for the isolation and unequivocal characterization of the enzyme from the cell-virus mixture by subcellular fractionation and chromatographic separation from cellular DNA polymerases. Purified RNA-directed DNA polymerase had the same primer-template characteristics, sedimentation properties, and immunological cross reactivity as the enzyme purified from density gradient-banded virions of simian sarcoma virus. Methods involving total extraction of the cell-virus mixture either by repeated freezing and thawing followed by detergent treatment or by Dounce homogenization and treatment with high salt and detergent failed to provide RNA-directed DNA polymerase free of cellular DNA polymerases. Because of this, low levels of cellular RNA-directed DNA polymerase may be missed when these approaches are used.
...
PMID:A comparative evaluation of methods for isolation of RNA-directed DNA polymerase from cells in a reconstituted system. 5 69

In the post-mitochondrial fraction of murine LBN/b leukemic cells, four fractions with DNA polymerase activity (I, II, III, IV) were found. On the basis of ion exchanger affinity and poly(A), poly(C) and poly(Cm) replication ability, fraction I was classified as RNA-directed DNA polymerase of viral origin. On the basis of the differences in the ion exchanger affinity, molecular weight, template requirement, pH-dependence of enzymatic activity and NaCl concentration, divalent ion requirements and susceptibility to N-ethylmaleimide inhibition, fractions II, III and IV were classified as DNA-directed DNA polymerases beta, alpha and gamma, respectively. Three fractions, i.e. reverse transcriptase, and DNA-directed DNA polymerases beta and gamma, were found to incorporate dTMP on a poly(A)-oligo(dT) template-primer. Despite the similarity of the reaction of DNA polymerases beta and gamma with poly(A)-oligo(dT), some other properties of these enzymes suggest that they represent distinct enzymatic entities.
...
PMID:DNA polymerases of murine LBN/b leukemic cells. 5

Two approaches have been explored for the synthesis of double-stranded DNA from single-stranded DNA template complementary to rabbit 9S globin mRNA (cDNA). (i) cDNA was elongated with dCMP or dTMP homopolymeric tracts using terminal deoxynucleotidyltransferase (EC 2.7.7.31; nucleosidetriphosphate:DNA deoxynucleotidylexotransferase). cDNA-dC, in the presence of an oligo(dG)10 primer, was an efficient template with either DNA polymerase of Escherichia coli (EC 2.7.7.7; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase) or RNA-directed DNA polymerase of avian myeloblastosis virus. cDNA-dT [ with an oligo(dA)10 primer] functioned as template only with E. coli polymerase. (ii) cDNA, without homopolymeric tails, was also efficiently copied in the absence of oligonucleotide primer, by DNA polymerase of avian myeloblastosis virus or of E. coli. The product of the reaction consisted of long hairpin molecules which could be converted into DNA duplex (melting temperature, 93 degrees) by digestion with single-strand nuclease S1. The data indicate that a loop structure on the 3' end of cDNA allowed DNA synthesis to take place by a "self-priming" mechanism. Some of the double-stranded DNA synthesized corresponded to the entire sequence of the 9S mRNA template. The synthesis of full-length double-stranded DNA from mouse globin mRNA and immunoglobulin light chain mRNA is also discussed.
...
PMID:Stepwise biosynthesis in vitro of globin genes from globin mRNA by DNA polymerase of avian myeloblastosis virus. 6 60

An RNA-directed DNA polymerase associated with transformation-defective (td) segregant of Rous sarcoma virus (RSV) has been characterized. The enzyme required both a monovalent and a divalent cation, a sulfhydryl reducing agent, and all four deoxyribonucleoside triphosphates for the expression of maximal activity. Sensitivity of the endogenous RNA-directed DNA polymerase activity to a low concentration of pancreatic RNase indicated that the enzyme utilized the td virus endogenous RNA as template. Maximal DNA synthesis was observed in a reaction mixture of pH 8 - 8.5 at 45 C with a manganese concentration of 1 mM. The enzyme of the td virus responded to exogenous template-primers in a manner characteristic of DNA polymerase of RNA tumor viruses, and the response became substantially greater when noncomplementary precursors were omitted from the reaction mixture. The endogenous reaction kinetics were examined. Three phases of DNA synthesis could be distinguished. Evidence was obtained showing that during the third and slowest phase of DNA synthesis the reaction mixture was not depleted of precursors and that the enzyme was fully active to initiate DNA synthesis with newly-added viral or synthetic RNA templates. Comparison of TMP and dAMP incorporation kinetics suggested that at the initial phase the enzyme preferentially copies A-rich region(s) of viral RNA. A comparison was also made between the endogenous reaction of the td virus and that of its parent sarcoma virus. The pH optimum, metal ion requirements, effect of sulfhydryl agents, response to exogenous template-primers, and kinetics of DNA synthesis, were all compared. No significant difference between the reaction of the td virus and its sarcomatogenous counterpart could be demonstrated.
...
PMID:Endogenous DNA polymerase of a transformation-defective rous sarcoma virus: characterization and comparison with the enzyme of the non-defective parent. 6 91

Radioactively labelled DNAs (5 X 10(6) cpm/mug) complementary to human 18 S and 28 S ribosomal RNA were synthesized using RNA-directed DNA polymerase (EC 2.7.7.7). These complementary DNAs were used to measure human ribosomal gene numbers by two independent methods, both of which indicated numbers at least four-fold lower than those previously reported. First, the kinetics of the annealing of the complementary DNAs with total human placental DNA indicated that the number of both 18-S and 28-S ribosomal genes per haploid genome is approximately 50. Second, saturation experiments in which a constant amount of DNA was annealed with increasing amounts of complementary DNA also indicated that the number of 28 S ribosomal RNA genes in human placental and spleen DNA is is about 50 per haploid genome.
...
PMID:A new estimate of human ribosomal gene number. 6 94

Rauscher leukemia virus RNA-directed DNA polymerase has been purified to near homogeneity (greater than 90% pure) using affinity chromatography on polycytidylate-agarose with over 85% recovery of input enzymatic activity. The purified enzyme has a molecular weight of approximately 70,000 and appears to consist of a single polypeptide chain. The enzyme is free of DNase, but has RNase H activity. Analysis of the requirements for optimal rates of DNA synthesis by this enzyme using synthetic and natural template-primers has revealed template-specific variations in such requirements. During these studies it was observed that DNA synthesis catalyzed by Rauscher leukemia virus DNA polymerase is inhibited by the addition of inorganic phosphate. An analysis of the mechanism of phosphate inhibition was carried out using the synthetic template-primer poly(A)-(dT)10. It appears that by some mechanism, possibly involving the substrate binding site of the enzyme, phosphate ions inhibit DNA synthesis with a more acute effect on the rate of chain growth than on that of initiation. The extension of these studies to DNA synthesis catalyzed by a variety of mammalian type C viral reverse transcriptases revealed that low levels ( less than or equal to 2 mM) of inorganic phosphate strongly inhibited DNA synthesis. The susceptibility to phosphate inhibition appears unique to mammalian type C viral enzymes since the type B viral enzyme, Escherichia coli DNA polymerase I, avian myeloblastosis virus and Mason Pfizer monkey tumor virus reverse transcriptase and cellular DNA polymerases alpha and gamma are not inhibited by inorganic phosphate. This phenomenon of phosphate inhibition of various DNA polymerases, therefore, provides a new basis for the differentiation of the sources and nature of these enzymes.
...
PMID:Purification and properties of Rauscher leukemia virus DNA polymerase and selective inhibition of mammalian viral reverse transcriptase by inorganic phosphate. 6 68

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84


<< Previous 1 2 3 4 5 6 7 8 Next >>