Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.7.7 (DNA polymerase)
17,007 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Purified reverse transcriptase from avian myeloblastosis virus or Rous sarcoma virus consists of two subunits of average mol wt of 100,000 and 60,000. The lower-molecular-weight subunit, alpha, has been isolated from avian myeloblastosis virus, Rous sarcoma virus and a temperature-sensitive mutant of Rous sarcoma virus, LA337. Subunit alpha manifests both the DNA polymerase and RNase H activities associated with purified reverse transcriptase of avian RNA tumor viruses. The thermal inactivation of these enzymatic activities of alpha subunit from the wild-type virus. The results show that both DNA polymerase and RNase H activities associated with the alpha subunit of LA337 are five to seven times more thermolabile then the corresponding alpha subunit from the wild-type virus. It is concluded that (i) both the polymerase and nuclease activities reside on the same polypeptide chain, and (ii) at least the lower-molecular-weight subunit alpha is coded for by the viral RNA.
...
PMID:Studies on reverse transcriptase of RNA tumor viruses. I. Localization of thermolabile DNA polymerase and RNase H activities on one polypeptide. 4 81

9-O-methyloximd erythromycin A and its analogue inhibited reverse transcriptase and blocked focus formation of Rous sarcoma virus. These chemicals inhibited neither DNA-dependent DNA polymerase nor DNA-dependent RNA polymerase from bacterial sources. However, they inhibited reverse transcriptase with an apparently differnt mechanism than that by rifamycin ABDP.
...
PMID:Oxime derivatives of erythromycin: inhibitors of Rous sarcoma virus reverse transcriptase activity and focus formation. 4 82

The RNA-directed DNA polymerase of Rous sarcoma virus requires a 4S RNA molecule as primer for the initiation of DNA synthesis on the viral 70S RNA genome. We have now functionally identified primer activity in uninfected cells on the basis of the capacity of cellular 4S RNA to actively participate in the initiation of DNA synthesis by the RNA-directed DNA polymerase of Rous sarcoma virus in vitro. This was accomplished by reconstitution experiments in which 4S RNA from uninfected avian cells was tested for its ability to restore template activity to the viral RNA genome from which all primer had been removed. Similar reconstitution experiments were employed to demonstrate a primer activity in the 4S RNA population of duck, mouse, and human cells. Primer activity appears to be absent in lower eukaryotic or prokaryotic cells. Unambiguous identification of the Rous sarcoma virus primer molecule in uninfected cells was accomplished by directly purifying a 4S RNA molecule from the bulk of host cell transfer RNA and establishing structural similarities between this cellular 4S RNA species and the Rous sarcoma virus primer by two-dimensional paper electrophoresis of oligonucleotides obtained from a T1 ribonuclease digest of the RNA species. We conclude that the Rous sarcoma virus DNA polymerase can utilize a host cell molecule as primer for the initiation of RNA-directed DNA synthesis in vitro.
...
PMID:RNA-directed DNA synthesis by the DNA polymerase of Rous sarcoma virus: structural and functional identification of 4S primer RNA in uninfected cells. 4 51

Reticuloendotheliosis virus (REV) contains an endogenously instructed, RNA-directed DNA polymerase activity. Both the endogenous and exogenous DNA polymerase activities exhibited up to 10-fold greater activity at the optimum concentration of manganous ion (0.025 mM for exogenous; 0.25 mM for endogenous) than at any concentration of magnesium ion. Antiserum to the DNA polymerase of an REV group virus (spleen necrosis virus) inhibited both endogenous and exogenous DNA polymerase activity of REV, whereas antiserum to the Rous sarcoma virus (Rous-associated virus-0) [RSV(RAV-0)]DNA polymerase did not. The DNA product of the endogenous reaction is associated with the high-molecular-weight RNA of REV and anneals with REV RNA but not with RNA from Rous sarcoma virus.
...
PMID:RNA-directed DNA polymerase activity of reticuloendotheliosis virus: characterization of the endogenous and exogenous reactions. 5 35

We have studied the effect of protein phosphokinase (EC 2.7.1.37; ATP:protein phosphotransferase) and phosphoprotein phosphatase (EC 3.1.3.16; phosphoprotein phosphohydrolase) on reverse transcriptase (RNA-dependent DNA nucleotidyltransferase) activity of Rous sarcoma virus. Protein kinase from Rous sarcoma virus-transformed chick embryo fibroblasts was purified by DEAE-cellulose chromatography, Sephadex gel filtration, and isoelectric focusing. Purified reverse transcriptase from Rouse sarcoma virus was preincubated with protein kinase and ATP under conditions allowing incorporation of phosphate into substrate protein. After the preincubation, reverse transcriptase activity was assayed in the presence of poly(rA).oligo(dT) as template. A 2- to 5-fold increase of reverse transcriptase activity was found after the preincubation of reverse transcriptase with protein kinase and ATP. Incubation of reverse transcriptase with heat-treated, inactive protein kinase and ATP had no effect on transcriptase activity. When the transcriptase preparation was incubated with protein kinase and [gamma-32P]ATP and subsequently purified by chromatography on phosphocellulose and Sephadex gel filtration, significant amounts of 32P-labeled proteins were found in the fractions exhibiting reverse transcriptase activity, suggesting 32P incorporation into transcriptase or transcriptase-associated proteins. A 20-60% decrease of reverse transcriptase activity was observed after incubation of reverse transcriptase with phosphatase. The results suggest that phosphorylative modification of reverse transcriptase may be critical in the regulation of reverse transcriptase-catalyzed DNA synthesis.
...
PMID:Protein kinase and its regulatory effect on reverse transcriptase activity of Rous sarcoma virus. 5 72

Phosphonoacetate is a highly specific inhibitor of herpes simplex virus-induced DNA polymerase. Sensitivity of herpesvirus type 1 or type 2 induced DNA polymerase to the drug was similar. However, DNA polymerases from other sources such as the host cells (Wi-38), Micrococcus luteus, and hepatitis B virus were highly resistant. In addition, Escherichia coli RNA polymerase and reverse transcriptase of Rous sarcoma virus were also insensitive to the drug. Enzyme kinetic studies showed that inhibition was noncompetitive with respect to deoxyribonucleotide triphosphates. The Ki value was about 0.45 muM. The apparent Km values for dTTP, dATP, dCTP, and dGTP were 0.71, 0.75, 0.42, and 0.39 muM, respectively. The base composition of template has no profound effect on the extent of inhibition. The drug caused uncompetititve inhibition with respect to template which indicated that phosphonoacetate did not bind directly to template DNA. Results are presented which suggest that phosphonoacetate did not affect the formation of the enzyme-DNA complex but probably inhibited the elongation step of DNA polymerase reaction.
...
PMID:Mode of inhibition of herpes simplex virus DNA polymerase by phosphonoacetate. 5 71

DNA polymerase from RNA tumor viruses ("reverse transcriptase") has been analyzed for activities which have been associated with other DNA polymerases. Homogeneous DNA polymerase from avian myeoblastosis virus catalyzes pyrophosphate exchange and pyrophosphorolysis. Pyrophosphate exchange is dependent on a template and is base-specific. With avian myeloblastosis virus DNA polymerase, ribonucleotide templates are more efficient for synthesis while deoxyribonucleotide templates are more effective for pyrophosphate exchange. Synthesis, pyrophosphate exchange, and pyrophosphorolysis were inhibited by the chelating agent 1,10-phenanthroline, suggesting that enzyme-bound zinc is required for each of these reactions. The pyrophosphate exchange reaction was also demonstrated with the DNA polymerase from a mutant of Rous sarcoma virus that possesses a temperature-sensitive DNA polymerase. The pyrophosphate exchange reaction with the mutant polymerase is temperature-sensitive which demonstrates that pyrophosphate exchange is indeed catalyzed by the viral DNA polymerase and that the same mutation effects both DNA polymerase and pyrophosphatase activity. Unlike Escherichia coli DNA polymerase I, the DNA polymerase from avian myeloblastosis virus fails to degrade polydeoxyribonucleotides or to convert deoxynucleoside triphosphates into monophosphates. This lack of hydrolytic activities in avian myeoblastosis DNA polymerase should facilitate kinetic studies on the mechanism of DNA synthesis by this enzyme.
...
PMID:On the fidelity of DNA replication. Enzyme activities associated with DNA polymerases from RNA tumor viruses. 5 14

Cocultivation of cells derived from embryos of golden pheasants or Amherst pheasants with chicken embryo cells infected with Bryan strain of Rous sarcoma virus resulted in the detection of viruses which appear to be endogenous in these pheasant cells. The pheasant viruses (PV) were similar to avian leukosis-sarcoma viruses (ALSV) in their gross morphology, in the size of their RNA, in the presence of a virion-associated RNA-dependent DNA polymerase (DNA nucleotidyltransferase; deoxynucleoside triphosphate: DNA deoxynucleotidyltransferase; EC 2.7.7.7), and in their growth characteristics. PV also serves as a helper for the glycoprotein-defective Rous sarcoma virus. However, PV was shown to be different from both ALSV and reticuloendotheliosis virus in the following properties: (i) PV does not have ALSV group specific antigens; (ii) the protein composition of PV is different from those of the other two groups of viruses; (iii) PV fails to complement the defective polymerase of alpha type Rous sarcoma virus; and (iv) PV RNA shows no detectable homology with nucleic acids of the other two groups of viruses. Thus, PV appears to be a new class of RNA viruses which contain RNA-dependent DNA polymerase.
...
PMID:Pheasant virus: new class of ribodeoxyvirus. 5 21

An RNA-directed DNA polymerase associated with transformation-defective (td) segregant of Rous sarcoma virus (RSV) has been characterized. The enzyme required both a monovalent and a divalent cation, a sulfhydryl reducing agent, and all four deoxyribonucleoside triphosphates for the expression of maximal activity. Sensitivity of the endogenous RNA-directed DNA polymerase activity to a low concentration of pancreatic RNase indicated that the enzyme utilized the td virus endogenous RNA as template. Maximal DNA synthesis was observed in a reaction mixture of pH 8 - 8.5 at 45 C with a manganese concentration of 1 mM. The enzyme of the td virus responded to exogenous template-primers in a manner characteristic of DNA polymerase of RNA tumor viruses, and the response became substantially greater when noncomplementary precursors were omitted from the reaction mixture. The endogenous reaction kinetics were examined. Three phases of DNA synthesis could be distinguished. Evidence was obtained showing that during the third and slowest phase of DNA synthesis the reaction mixture was not depleted of precursors and that the enzyme was fully active to initiate DNA synthesis with newly-added viral or synthetic RNA templates. Comparison of TMP and dAMP incorporation kinetics suggested that at the initial phase the enzyme preferentially copies A-rich region(s) of viral RNA. A comparison was also made between the endogenous reaction of the td virus and that of its parent sarcoma virus. The pH optimum, metal ion requirements, effect of sulfhydryl agents, response to exogenous template-primers, and kinetics of DNA synthesis, were all compared. No significant difference between the reaction of the td virus and its sarcomatogenous counterpart could be demonstrated.
...
PMID:Endogenous DNA polymerase of a transformation-defective rous sarcoma virus: characterization and comparison with the enzyme of the non-defective parent. 6 91

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84


1 2 3 4 5 6 Next >>