Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.7.7 (
DNA polymerase
)
17,007
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase,
EC 2.7.7.7
) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W.
Gilbert
, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84
The cistron A protein induced by phage varphiX174 nicks (produces a single-strand break in) the viral strand of the superhelical varphiX duplex DNA, thereby forming a complex with the DNA. The protein, seen bound to the DNA in the electron microscope, was located in the restriction endonuclease fragment between nucleotides 4290 and 4330 on the varphiX map [Sanger, F., Air, G. M., Barrel, B. G., Brown, N. L., Coulson, A. R., Fiddes, J. C., Hutchison, C. A., III, Slocomb, P. M. Y. & Smith, M. (1977) Nature 265, 687-695]. Replication also was initiated at this point, thus identifying the site of cistron A protein nicking and binding as the origin of replication. The cisA-DNA complex (separated from free cistron A protein), upon the addition of Escherichia coli rep protein, ATP, and DNA binding protein, is unwound to generate a single-stranded linear [presumably the nicked (+) strand] and a circular [presumably the (-) strand] molecule. The cisA-DNA complex, upon the further addition of
DNA polymerase III
holoenzyme and deoxynucleoside triphosphates, supports replication to generate viral, single-stranded circles, as many as 15 circles per cisA-DNA complex. The replicating intermediates seen in the electron microscope are a novel form of "rolling circle" [
Gilbert
, W. & Dressler, D. H. (1969) Cold Spring Harbor Symp. Quant. Biol. 33, 473-485]. The 5' end (presumably with the cistron A protein bound to it) is locked in the replication fork and loops back to accompany the strand-separation and replication fork around the template [(-) strand] circle. Thus, the multiple functions of cistron A protein include: (i) nicking the viral strand at the origin of replication to initiate a round of replication, (ii) participating in a complex which supports fork movement in strand separation and replication, (iii) nicking again at the regenerated origin to produce a unit-length DNA, and (iv) ligating the newly generated 3'-OH end to the 5'-phosphate-complexed end to form a circular viral molecule.
...
PMID:phiX174 cistron A protein is a multifunctional enzyme in DNA replication. 26 83
A sequence of 1019 nucleotides encompassing one of the 600 base inverted repeats and non-repeated flanking regions has been determined in the type A yeast 2 micrometers plasmid cloned in pMB9. Methods are described for applying the Maxam-
Gilbert
sequencing procedure to DNA fragments labelled at the 3'-end using a T4-polymerase exchange/repair reaction and for sequencing 5'-end labelled fragments using dideoxy-nucleotides as chain terminators in the presence of E. coli
DNA polymerase
(nach Klenow). A notable feature of the sequence is its unusual content of symmetry elements. In one region of 140 nucleotides, 137 are involved in a complex arrangement of direct and inverted repeats linked by palindromic sequences.
...
PMID:Sequence of 1019 nucleotides encompassing one of the inverted repeats from the yeast 2 micrometer plasmid. 38 82
CC-1065, a cyclopropylpyrroloindole (CPI), is a highly potent antitumor DNA-alkylating agent. We have devised a simple method to detect CPI bonding sites on double-stranded DNA (dsDNA). The technique utilizes a modified form of bacteriophage T7 polymerase, Sequenase, to synthesize a radiolabeled nascent strand from dsDNA that has been reacted in vitro with the CC-1065 analogue U-73975 (adozelesin). The reaction products were electrophoresed on sequencing gels containing 8 M urea and visualized by autoradiography. The transit of this
DNA polymerase
is inhibited at the sites where CPIs are bound to the template strand. Thus, the enzyme stalls or stops at the nucleotide immediately adjacent to the modified base, resulting in the accumulation of DNA strands at these sites and in diminished read-through beyond these sites in a set of CPI-treated DNA molecules. The precise positions of polymerase inhibition can be determined by comparison of CPI-treated and unreacted DNA reactions. This modified dideoxynucleotide sequencing technique has been used to establish the sequence selectivity of U-73975. Approximately 1 kilobase of dsDNA has been analyzed to derive a consensus canonical bonding sequence, 5'(T/A)-T/A-T-A*-(C/G)-(G), where A* is the site of U-73975 alkylation and parentheses denote deoxynucleotide preferences. Noncanonical sites were also found at poly(A) sites. This technique yielded a consensus sequence for U-73975 bonding that is similar to, but not identical with, the published consensus obtained for CC-1065 by a modified Maxam and
Gilbert
sequencing technique. We have also examined the bonding of [3H]U-73975 to the DNA of viable cultured mammalian cells, using gel electrophoresis and autoradiographic techniques.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:In vitro and in vivo DNA bonding by the CC-1065 analogue U-73975. 185 54
There are two established procedures for sequencing cloned DNA fragments. In Maxam-
Gilbert
sequencing, or sequencing by chemical degradation, end-labeled DNA is treated with various chemicals which induce base specific chain breaks with a low frequency. In dideoxy sequencing, or sequencing by the Sanger procedure, a single-stranded DNA is used as a template for synthesis of a labeled complementary strand by a
DNA polymerase
. Addition of dideoxynucleoside triphosphates will induce base-specific chain termination. In both procedures the nucleotide sequence of the cloned DNA can be deduced after fractionation of the labeled products by polyacrylamide gel electrophoresis. As yet, radioactive labeling of the reaction products is most common, but fluorescence labeling and computer-assisted automated sequence interpretation has become as a powerful alternative during the last years. Further automation of the various processes involved in DNA sequencing will be necessary for the planned sequencing of large genomes, such as the Escherichia coli genome, the yeast genome, and the human genome.
...
PMID:[Gene technology in clinical medicine--DNA sequencing]. 281 28
pBR322 DNA, linearized by lysis of an oxolinic acid-treated culture of Escherichia coli strain DK6recA- (pBR322) with sodium dodecyl sulfate, was purified, treated with
DNA polymerase
in the presence of the four deoxynucleoside triphosphates, and ligated to DNA linkers containing the XhoI recognition sequence. Most of the drug-resistant colonies resulting from transformation of E. coli with this material bore plasmids that appeared by restriction enzyme analysis to differ from pBR322 only by the introduction of an XhoI site. The XhoI sites in plasmids from 93 transformants were distributed unevenly around the pBR322 map. Maxam-
Gilbert
DNA sequence analysis of 36 of these plasmids, labeled at the 5' termini of the XhoI sites, revealed that 29 of them contained, in addition to the XhoI linker, a duplication of four base-pairs of the pBR322 sequence surrounding the linker. Therefore, oxolinic acid-induced linearization must have resulted in 5'-terminal extensions of four bases, the configuration known to result from oxolinic acid-induced DNA cleavage by DNA gyrase in vitro. The sequence data thus allowed the determination of the precise point at which linearization occurred, apparently by the abortion of a gyrase-DNA covalent intermediate that existed in vivo. When the 19 different sites of the 29 plasmids were compared, the following set of rules could be derived: (formula; see text) where N is any nucleotide, R is a purine, and Y is a pyrimidine. Cleavage occurred at the line between the eighth and ninth positions from the left. The parenthetical G and T were preferred secondarily to T and G, respectively, whereas T and G in the 13th position from the left were equally preferred. Several of these rules are similar to those proposed previously based on several in vitro gyrase cleavage sites. Some of our rules show dyad symmetry around the axis midway between the cleavage points in the two strands, while others are distinctly asymmetric.
...
PMID:Sites of reaction of Escherichia coli DNA gyrase on pBR322 in vivo as revealed by oxolinic acid-induced plasmid linearization. 298 30
The enzymatic domains of the avian retrovirus polymerase (pol) gene have been mapped by the use of peptide antibodies and COOH-terminal amino acid analysis. The processed pol beta polypeptide is cleaved in vivo to yield alpha and pp32. Rabbit antibodies were directed against synthetic peptides whose sequence was deduced from the known pol sequence of Rous sarcoma virus, Prague C (Schwartz, D.E., Tizard, R., and
Gilbert
, W. (1983) Cell 32, 853-869). The RNase H active site of pol was located in the NH2-terminal region of the alpha
DNA polymerase
subunit. The COOH terminus of the alpha subunit was found to be immediately adjacent to the NH2 terminus of the pp32 pol protein. COOH-terminal amino acid analysis of pp32 revealed that this protein is also processed. From the deduced amino acid sequence of pol, it appears likely that pol encodes an additional 4100-dalton polypeptide located at its extreme COOH terminus. The enzymatic domains on beta appear to map in the following order: RNase H-
DNA polymerase
-DNA endonuclease. Hydrophilicity analysis and secondary structure predictions of wild type Rous sarcoma virus pol products and mutated pp32 possessing single amino acid changes permit further structural evaluation of the multifunctional pol protein.
...
PMID:Structural characterization of the avian retrovirus reverse transcriptase and endonuclease domains. 298 84
RNA of a flavivirus, tick-borne encephalitis virus (TBEV; strain Sofjin), was subjected to reverse transcription and the DNA copy was transformed into double-stranded DNA by the action of E. coli DNA-polymerase I (
Klenow fragment
). This DNA was annealed with plasmid pBR322. The recombinant plasmids were cloned in E. coli K802. The nucleotide sequence of the inserts of the clones, coding for region structural proteins C, M, E and nonstructural protein NS1, was determined by the Maxam-
Gilbert
method. The genes of structural proteins form a compact cluster. Homology has been studied of the TBEV sequences found with the structures of proteins and RNAs of other flaviviruses, yellow fever virus and West Nile virus, and a high degree of homology was found.
...
PMID:Tick-borne encephalitis virus genome. The nucleotide sequence coding for virion structural proteins. 370 96
DNA-sequencing techniques can be adapted to provide powerful analytical tools for pinpointing the sites at which DNA is modified by either radiations or chemicals. Base modifications, covalent adducts, crosslinks, and noncovalent binding can all be detected. This review outlines the adaptions of the Maxam-
Gilbert
and Sanger dideoxy sequencing techniques which make such studies possible. Practical aspects and limitations of the various methods are given. Assays which test the ability of
DNA polymerase
to bypass damage and misincorporate bases are also discussed. It is concluded that these techniques constitute the most powerful method currently available for the study of sequence-specific DNA interactions.
...
PMID:Site-specific analysis of drug interactions and damage in DNA using sequencing techniques. 389 15
The nucleotide sequence of an EcoRI duck hepatitis B virus (DHBV) clone was elucidated by using the Maxam and
Gilbert
method. This sequence, which is 3,021 nucleotides long, was compared with the two previously analyzed hepatitis B-like viruses (human and woodchuck). From this comparison, it was shown that DHBV is derived from an ancestor common to the two others but has a slightly different genomic organization. There was no intergenic region between genes 5 and 8, which were fused into a single open reading frame in DHBV. Genes for the surface and core proteins were assigned to open reading frames 7 and 5/8. Amino acid comparisons showed some structural relationship between gene 6 product and avian reverse transcriptase, suggesting either evolution from a common ancestor or convergence to some particular structure to fulfill a specific function. This should be correlated with the synthesis of an RNA intermediate during DNA replication. This is also taken as an argument in favor of the hypothesis that gene 6 codes for the
DNA polymerase
that is found within the virion. DNA sequence comparison also showed that the two mammalian hepatitis B viruses are more homologous to each other than they are to DHBV, indicating that DHBV starts to evolve on its own earlier than the two other viruses, as do birds compared with mammals. From this it is proposed that the viruses evolved in a fashion parallel to the species they infect.
...
PMID:Nucleotide sequence of a cloned duck hepatitis B virus genome: comparison with woodchuck and human hepatitis B virus sequences. 669 38
1
2
Next >>