Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.7.7.6 (RNA polymerase)
34,946 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Dimethylnitrosamine maximally inhibits rat liver nuclear RNA synthesis by 50% at a dose of 40 mg/kg of body weight. The inhibition develops during the first 4 hr and persists through the 12th hr. All parenchymal cells of the lever lobule seem to be affected. The decreased RNA synthesis can be accounted for entirely by an inhibition of the RNA polymerase activities quantitatively solubilized and partially purified. A similar inhibition of the polymerase activities was demonstrated in the intact nuclei by inactivating the endogenous template with actinomycin D and assaying the polymerases with an added exogenous template, poly(deoxy-adenylate-deoxythymidylate). Chromatin was prepared by two methods differing in the extent to which they remove the endogenous polymerase activity. Each preparation was transcribed with either added Escherichia coli or partially purified rat liver nucleoplasmic RNA polymerase. With either polymerase or chromatin preparation, no inhibition of the template activity of liver nuclear chromatin isolated from the DMN-treated animals was detected. A similar mechanism of inhibition of RNA synthesis was produced by the action of the methylating agent methyl methanesulfonate on whole nuclei in vitro. The dose-dependent inhibition of RNA synthesis could be accounted for by an inhibition of the RNA polymerase activities quantitatively solubilized and partially purified from the affected nuclei. Chromatin prepared from the methyl methanesulfonate-treated nuclei had a normal template capacity with either E. coli or rat liver nucleoplasmic RNA polymerase. No preferential methylation of the RNA polymerases by [14C]methyl methanesulfonate could be demonstrated. It is concluded that the action of the two methylating agents on RNA metabolism is similar and that the inhibition of liver nuclear RNA synthesis results from inactivation of the RNA polymerases. At the same time, dimethylnitrosamine and methyl methanesulfonate leave the chromatin template intact, at least quantitatively, for the synthesis of RNA. The implications of such an effect on RNA synthesis are discussed.
...
PMID:Inhibition of rat liver RNA polymerases by action of the methylating agents dimethylnitrosamine in vivo and methyl methanesulfonate in vitro. 17 32

We have studied the toxic effects of alkylating agents with a well characterized model: phage T7. Treatment of bacteriophage T7 with methyl methanesulfonate led to perturbation of phage-specific protein synthesis. Synthesis of class I and II proteins was prolonged, while production of class II and III proteins was delayed. This delay increased for proteins coded by genes located further to the right on the T7 genetic map. In extracts prepared from cells infected by alkylated phage, the specific activity of T7 RNA polymerase was decreased. These results suggest that the toxic action of methyl methanesulfonate is directed towards viral transcription.
...
PMID:[protein synthesis in alkylated bacteriophage T7]. 147 5

Using DNA ejection in vitro as a model, we have studied the DNA injection defect caused by alkylation and depurination of T7 bacteriophage. Phage was alkylated with 0.02 M methyl methanesulfonate for 2 h at 37 degrees C; alkylated phage was then incubated 24 h at 30 degrees C to induce depurination. These samples were treated with formamide to cause DNA ejection without dissociation of the phage capsid. After ejection, the phage preparations were analyzed by electron microscopy. DNA lengths in capsid-DNA complexes were measured; relative numbers of full, empty, and partially empty phage heads were determined. To establish the direction of DNA ejection, E. coli RNA polymerase was bound to capsid-DNA complexes. The results showed that DNA was partially ejected from both alkylated and depurinated phages. In the alkylated sample, RNA polymerase was bound to the DNA end distal to the capsid; this showed that ejection started from the genetic left end. We interpret these results to show, in confirmation of earlier results obtained by marker rescue, that alkylation causes T7 phage to partially inject its DNA, starting from the genetic left end. For depurinated phage, our results suggest that partial DNA injection is responsible, in this case as well, for the already documented injection defect.
...
PMID:Injection defect in alkylated and depurinated T7 bacteriophage: analysis by DNA ejection. 704

Treatment of bacteriophage T7 with methyl methanesulfonate perturbed phage-specific genetic expression in both repair-proficient and repair-deficient Escherichia coli cells. In wild-type cells (AB1157), the time course of protein synthesis was slowed down but an entire complement of phage proteins was synthesized. In cells (BK2114, tag-) unable to repair 3-methyladenine, the toxic lesion produced by methyl methanesulfonate, alkylated phage produced only early (class I) proteins. These results suggested that late transcription was inhibited in infected tag- cells. These cells were shown to contain a significant amount of active T7 RNA polymerase, a class I protein. Thus, the cause of inhibition appeared to be the inability of T7 RNA polymerase to use unrepaired DNA as template. In vitro transcription assays with alkylated T7 DNA as template supported this proposal. T7 RNA polymerase proved to be very sensitive to the presence of alkylation lesions. In addition, the phage enzyme was much more sensitive to these lesions than was its bacterial counterpart, E. coli RNA polymerase. These results suggest that 3-methyladenine exerts its toxic action, in the T7 system, at the level of transcription by T7 RNA polymerase. To further characterize the reduced activity of the T7 enzyme, an in vitro transcription assay using linearized plasmid DNA with one T7 promoter was devised. Gel electrophoresis revealed that only one transcript of well-defined length was synthesized by T7 RNA polymerase on this template. Alkylation of the template did not alter the size of the transcript produced. Simultaneous measurement of chain initiation and chain elongation confirmed this result by showing that both steps were reduced to the same extent by alkylation of template DNA. Thus T7 RNA polymerase does not appear to be blocked by 3-methyladenine. Rather the lesion must hinder translocation of T7 RNA polymerase along the DNA template during chain elongation.
...
PMID:Mechanism of toxicity of 3-methyladenine for bacteriophage T7. 769 68

Drosophila Rrp1 protein has four tightly associated enzymatic activities: DNA strand transfer, ssDNA renaturation, dsDNA 3'-exonuclease and apurinic/apyrimidinic (AP) endonuclease. The carboxy-terminal region of Rrp1 is homologous to Escherichia coli exonuclease III and several eukaryotic AP endonucleases. All members of this protein family cleave abasic sites. Rrp1 protein was expressed under the control of the E. coli RNA polymerase tac promoter (pRrp1-tac) in two repair deficient E. coli strains (BW528 and LG101) lacking both exonuclease III (xth) and endonuclease IV (nfo). Rrp1 confers resistance to killing by oxidative, antitumor and alkylating agents that damage DNA (hydrogen peroxide, t-butylhydroperoxide, bleomycin, methyl methanesulfonate, and mitomycin C). Complementation of the repair deficiency by Rrp1 provides up to a two log increase in survival and requires the C-terminal nuclease region of Rrp1, but not its N-terminal region. The AP endonuclease activity in extracts from the repair deficient strain LG101 is increased up to 12-fold when the strain contains pRrp1-tac. These results indicate that pRrp1-tac directs the synthesis of active enzyme, and that the nuclease activities of Rrp1 are likely to be the cause of the increased resistance to DNA damage of the mutant cells.
...
PMID:Drosophila Rrp1 complements E. coli xth nfo mutants: protection against both oxidative and alkylation-induced DNA damage. 769 34

The regulation of the recA gene expression in the obligately anaerobic rumen bacterium Prevotella ruminicola was investigated by monitoring the recA-specific transcript level. P. ruminicola recA forms a monocistronic unit, but no SOS-box sequences resembling those of Escherichia coli or Bacillus subtilis can be identified upstream of the recA coding region. At the same time, we observed a fivefold increase in the level of recA mRNA in response to DNA damaging agents, mitomycin C and methyl methanesulfonate, as well as under conditions of oxidative stress. No induction was detected when growth of P. ruminicola was arrested by shifting to acidic (pH 4.8) conditions. Primer extension experiment revealed the three very close transcriptional start sites for recA. The putative -10 and -35 RNA polymerase binding regions were proposed on the basis of transcript mapping. These regions bear very little similarity to the E. coli (sigma70) and B. subtilis (sigmaA) consensus sequences, as well as to the recognition sites of other minor sigma-factors. Transcript mapping experiments in E. coli expressing P. ruminicola recA confirmed that the transcription machineries of these two bacteria recognize completely different regulatory sequences on the template to initiate transcription. Preliminary DNase I footprinting analysis data revealed that the region of imperfect dyad symmetry (AATTATAATCAATTATAAAT) found between the putative -10 region and the translation initiation codon may serve as an SOS-box-like regulatory sequence in P. ruminicola. This sequence bears no similarity to the known SOS-box sequences and, in particular, to that of E. coli and other Gram-negative bacteria.
...
PMID:Transcriptional regulation of the Prevotella ruminicola recA gene. 954 60

Bacillus subtilis DB1005 is a temperature-sensitive (Ts) sigA mutant. Induction of sigmaA has been observed exclusively in this mutant harbouring extra copies of the plasmid-borne Ts sigA gene transcriptionally controlled by the P1P2 promoters of the B. subtilis macromolecular synthesis (MMS; rpoD or sigA) operon. Investigation of the mechanisms leading to the induction has allowed us to identify a sigmaB-type promoter, P7, in the MMS operon for the first time. Therefore, at least seven promoters in total are responsible for the regulation of the B. subtilis MMS operon, including the four known sigmaA- and sigmaH-type promoters, as well as two incompletely defined promoters. The P7 promoter was activated in B. subtilis after the imposition of heat, ethanol and salt stresses, indicating that the MMS operon of B. subtilis is subjected to the control of general stress. The significant heat induction of P7 in B. subtilis DB1005 harbouring a plasmid-borne Ts sigA gene can be explained by a model of competition between sigmaA and sigmaB for core binding; very probably, the sigmaB factor binds more efficiently to core RNA polymerase under heat shock. This mechanism may provide a means for the expression of the B. subtilis MMS operon when sigmaA becomes defective in core binding.
...
PMID:Identification and characterization of a stress-responsive promoter in the macromolecular synthesis operon of Bacillus subtilis. 1041 53

RAD26 in the yeast Saccharomyces cerevisiae is the counterpart of the human Cockayne syndrome group B (CSB) gene. Both RAD26 and CSB act in the preferential repair of UV lesions on the transcribed strand, and in this process, they function together with the components of nucleotide excision repair (NER). Here, we examine the role of RAD26 in the repair of DNA lesions induced upon treatment with the alkylating agent methyl methanesulfonate (MMS). MMS-induced DNA lesions include base damages such as 3-methyl adenine and 7-methyl guanine, and these lesions are removed in yeast by the alternate competing pathways of base excision repair (BER), which is initiated by the action of MAG1-encoded N-methyl purine DNA glycosylase, and NER. Interestingly, a synergistic increase in MMS sensitivity was observed in the rad26 Delta strain upon inactivation of NER or BER, indicating that RAD26 promotes the survival of MMS-treated cells by a mechanism that acts independently of either of these repair pathways. The galactose-inducible transcription of the GAL2, GAL7, and GAL10 genes is reduced in MMS-treated rad26 Delta cells and also in mag1 Delta rad14 Delta cells, whereas a very severe reduction in transcription occurs in MMS-treated mag1 Delta rad14 Delta rad26 Delta cells. From these observations, we infer that RAD26 plays a role in promoting transcription by RNA polymerase II through damaged bases. The implications of these observations are discussed in this paper.
...
PMID:Yeast RAD26, a homolog of the human CSB gene, functions independently of nucleotide excision repair and base excision repair in promoting transcription through damaged bases. 1202 48

Cells change their gene expression profile dynamically in various conditions. By taking the advantage of ChIP, we examined the transcription profile of Saccharomyces cerevisiae genes in response to DNA damaging agents such as MMS or 4NQO. Gene expression profiles of different groups of genes roughly correlated with that revealed by Northern blot assay or microarray method. Damage-inducible genes showed increased cross-linking signals of RNA polymerase II, TFIIH, and TFIIF, meanwhile damage repressible genes decreased them, which means that gene expression is mainly regulated at the level of transcription. Interestingly, the characteristic occupancy pattern of TFIIH and polymerase with phosphorylated carboxy-terminal domain (CTD) in promoter or in coding regions was not changed by the presence of DNA damaging agents in both non-inducible and inducible genes. ChIP data showed that the extent of phosphorylation of CTD per elongating polymerase complex was still maintained. These findings suggest that overall increase in CTD phosphorylation in response to DNA damage is attributed to the global shift of gene expression profile rather than modification of specific polymerase function.
...
PMID:Differential regulation of gene expression by RNA polymerase II in response to DNA damage. 1554 74

BRCA1 has been implicated in numerous DNA repair pathways that maintain genome integrity, however the function responsible for its tumor suppressor activity in breast cancer remains obscure. To identify the most highly conserved of the many BRCA1 functions, we screened the evolutionarily distant eukaryote Saccharomyces cerevisiae for mutants that suppressed the G1 checkpoint arrest and lethality induced following heterologous BRCA1 expression. A genome-wide screen in the diploid deletion collection combined with a screen of ionizing radiation sensitive gene deletions identified mutants that permit growth in the presence of BRCA1. These genes delineate a metabolic mRNA pathway that temporally links transcription elongation (SPT4, SPT5, CTK1, DEF1) to nucleopore-mediated mRNA export (ASM4, MLP1, MLP2, NUP2, NUP53, NUP120, NUP133, NUP170, NUP188, POM34) and cytoplasmic mRNA decay at P-bodies (CCR4, DHH1). Strikingly, BRCA1 interacted with the phosphorylated RNA polymerase II (RNAPII) carboxy terminal domain (P-CTD), phosphorylated in the pattern specified by the CTDK-I kinase, to induce DEF1-dependent cleavage and accumulation of a RNAPII fragment containing the P-CTD. Significantly, breast cancer associated BRCT domain defects in BRCA1 that suppressed P-CTD cleavage and lethality in yeast also suppressed the physical interaction of BRCA1 with human SPT5 in breast epithelial cells, thus confirming SPT5 as a relevant target of BRCA1 interaction. Furthermore, enhanced P-CTD cleavage was observed in both yeast and human breast cells following UV-irradiation indicating a conserved eukaryotic damage response. Moreover, P-CTD cleavage in breast epithelial cells was BRCA1-dependent since damage-induced P-CTD cleavage was only observed in the mutant BRCA1 cell line HCC1937 following ectopic expression of wild type BRCA1. Finally, BRCA1, SPT5 and hyperphosphorylated RPB1 form a complex that was rapidly degraded following MMS treatment in wild type but not BRCA1 mutant breast cells. These results extend the mechanistic links between BRCA1 and transcriptional consequences in response to DNA damage and suggest an important role for RNAPII P-CTD cleavage in BRCA1-mediated cancer suppression.
...
PMID:Yeast screens identify the RNA polymerase II CTD and SPT5 as relevant targets of BRCA1 interaction. 1819 58


1 2 Next >>

---