Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.7.6 (
RNA polymerase
)
34,946
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
A template-dependent
RNA polymerase
has been isolated from poliovirus-infected cells by assaying for the ability of the enzyme to copy poly(A) complexed to an oligo(U) primer. The polymerase was solubilized with detergent, and RNA was removed by precipitation with 2 M LiCl. The solubilized polymerase required both poly(A) and oligo(U) for activity and was stimulated by Mg2+ but was inhibited by Mn2+. Poly(A)-oligo(U)-dependent poly(U) polymerase was not found in extracts of HeLa cells until about 2 hr after poliovirus infection, and then there was a linear increase in activity until about 5 hr. Analysis of the polymerase by glycerol gradient centrifugation showed that the majority of the activity sedimented at about 4 S, indicating that it was no longer complexed with high-molecular-weight RNA or cellular membranes. This poly(A)-oligo(U)-dependent polymerase activity could represent an important component of the poliovirus RNA-dependent RNA polymerase.
Proc Natl Acad Sci U S A 1977
Sep
PMID:Poliovirus-specific primer-dependent RNA polymerase able to copy poly(A). 19 96
The 2S RNA synthesized in vitro by the
RNA polymerase
of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.
Cell 1978
Sep
PMID:The complete sequence of a unique RNA species synthesized by a DI particle of VSV. 21 97
The L and NS proteins of vesicular stomatitis virions (New Jersey serotype) were solubilized with Triton X-100 and high-salt buffer and recombined with purified nucleocapsids under conditions similar to those used to reconstitute
transcriptase
activity in vitro. The nucleocapsid-bound L and NS proteins were separated from unbound proteins on a glycerol gradient. The rebinding of L and NS proteins mimics the in vivo binding in that at saturation the ratio of L and NS molecules to N molecules is approximately the same as observed in the intact virion. L and NS proteins were separated and added back independently and in combination to the template. The purified NS protein bound to the template in the absence of L protein. However, the L protein binding appeared to depend on the presence of NS protein. The presence of Mg2+ and nucleotides, which is required for transcription, was not necessary for the rebinding of L and NS proteins.
J Virol 1978
Sep
PMID:Rebinding of transcriptase components (L and NS proteins) to the nucleocapsid template of vesicular stomatitis virus. 21 81
Purified cores of vesicular stomatitis virus contain an enzymatic activity that converts GDP, UDP, and CDP into their corresponding triphosphates using ATP as the phosphate donor. Thus, the virion-associated
RNA polymerase
can synthesize mRNA normally in vitro even when one of the ribonucleoside triphosphates is replaced by its corresponding diphosphate. RNA synthesis does not proceed if ATP is replaced by ADP. Similarly RNA synthesis is impaired if CDP and UDP are present in the same reaction. The role of the nucleoside diphosphate kinase (NDP kinase, EC 2.7.4.6) in vesicular stomatitis virus mRNA synthesis in vitro is discussed.
J Biol Chem 1979
Sep
25
PMID:Nucleoside diphosphate kinase activity in purified cores of vesicular stomatitis virus. 22 22
The diastereomers of adenosine 5'-O-(1-thiotriphosphate) (ATP alpha S) and adenosine 5'-O-(2-thiotriphosphate) (ATP beta S) can replace adenosine triphosphate (ATP) in the initiation reaction catalyzed by deoxyribonucleic acid (DNA) dependent ribonucleic acid (RNA) polymerase from Escherichia coli. In both cases, the Sp diastereomer is a better initiator than the Rp isomer. The diasteromers of 3'-uridyl 5'-adenosyl ,O-phosphorothioate [Up(S)A] can replace UpA in the primed initiation reaction catalyzed by
RNA polymerase
; however, the Rp diastereomer is a better initiator than the Sp isomer. By using ATP or CpA as initiator and UTP alpha S, isomer A, as substrate, we determined the stereochemical courses of both the initiation and primed initiation reactions, respectively, with T7 DNA template and found them to proceed with inversion of configuration. Determination of the stereochemical course of the pyrophosphate exchange reaction catalyzed by
RNA polymerase
provides evidence that this reaction is the reverse of the phosphodiester bond-forming reaction.
Biochemistry 1979
Sep
18
PMID:Mechanistic studies on deoxyribonucleic acid dependent ribonucleic acid polymerase from Escherichia coli using phosphorothioate analogues. 1. Initiation and pyrophosphate exchange reactions. 22 21
We have synthesized N2-[4-(2,2,6,6-tetramethyl-1-piperidinyloxy)]actinomycin D And the related 1,2-diaminoethane and 1,3-diaminopropane derivatives and evaluated their biological properties. Binding studies with the spin-labeled actinomycin D analogues and DNA were carried out by using circular dichroism, electron spin resonance, and thermal denaturation. These studies have suggested that the derivatives bind to DNA and that their DNA-binding modes are similar but not identical. Spin-labeled actinomycin D derivatives were less potent in inhibiting Escherichia coli
DNA-dependent RNA polymerase
reaction than actinomycin D and were less toxic to L1210 cells in vitro than the parent compound. Spin-labeled actinomycin D derivatives were more common than the parent compounds against P-388 leukemia cells in vitro with little or no toxicity.
J Med Chem 1979
Sep
PMID:Synthesis and biological properties of N2-substituted spin-labeled analogues of actinomycin D. 22 5
We have determined the orientation of 4 immediate early (IE) mRNA's on the herpes simplex virus type 1 genome by mapping cDNA's complementary to the 3'-termini of messages. These IE mRNA's are transcribed by a pre-existing cell
RNA polymerase
, and we propose a model which allows their synthesis from a circular template using a single virus promoter region. The promoter region, which is located in the two repetitive DNA regions which flank the short unique region of the virus genome, may serve to initiate bidirectional transcription of these IE mRNA's.
Nucleic Acids Res 1979
Sep
11
PMID:Orientation of herpes simplex virus type 1 immediate early mRNA's. 22 44
Purified non-histone proteins from mouse mammary cells bind specifically to homologous DNA or chromatin. Complexes of non-histone protein with DNA or chromatin, isolated on agarose columns, were transcribed with both Escherichia coli
RNA polymerase
and
RNA polymerase
B from calf thymus. The fact that complexing of DNA with non-histone proteins increases transcription by E. coli
RNA polymerase
but not by
RNA polymerase
B suggests different mechanisms of transcription by these two enzymes. Similar experiments with mouse and Drosophila chromatin indicate that non-histone proteins specifically stimulate the transcription of mouse chromatin by
RNA polymerase
B. Non-histone proteins stimulate the transcription of mouse mammary tumor virus sequences in chromatin by
RNA polymerase
B but not by E. coli
RNA polymerase
. We conclude that those non-histone proteins bound specifically to chromatin are able to activate the transcription of specific genes by eukaryotic
RNA polymerase
.
Eur J Biochem 1979
Sep
PMID:Regulation of transcription by DNA-bound non-histone nuclear proteins. 22 84
Lutropin and human choriogonadotropin stimulated the endogenous chromatin-associated polymerase activity in purified chromatin prepared from nuclei of bovine corpus luteum. Chromatin was incubated in two different buffer systems: one that mainly supports the activity of polymerase I, another that supports the activity of polymerase II and is largely alpha-amanitin sensitive. The hormones lutropin and chorigonadotropin stimulated an increase in the rate of incorporation of [14C]ATP or [14C]UTP into RNA in both buffer systems. Follitropin, prolactin and beta-corticotropin had no stimulatory effect. Neither the alpha nor beta subunit of lutropin stimulated RNA synthesis. When premixed, the subunits rapidly formed the active molecule. A maximum response to RNA synthesis was achieved by a 10(-9) M concentration of human choriogonadotropin. Considerable activity was obtained at 10(-11) M human choriogonadotropin. There was no lutropin stimulation to RNA synthesis using calf thymus DNA and Escherichia coli
RNA polymerase
.
Biochim Biophys Acta 1977
Sep
06
PMID:Lutropin stimulation of RNA synthesis in corpus luteum chromatin. 32 86
Through the use of phage mutants in which various combinations of the early genes are active, and in which late gene expression is blocked, we have examined the roles of each of the five early gene products of bacteriophage T7 in regulating the synthesis of host RNA and proteins. At least two independent transcriptional controls operate during bacteriophage T7 development. The product of gene 0.7, acting alone, leads to a rapid (by 5 min) shutoff of host transcription. In the absence of gene 0.7 function, and in the absence of the phage-specified
RNA polymerase
, a delayed shutoff of host-dependent transcription begins at approximately 15 min after infection. This secondary control element requires either a functional gene 0.3 or gene 1.1. In the absence of any early gene products, host shutoff is not observed until much later in infection (>30 min). The delayed manner in which the products of genes 0.3 and 1.1 exert their effect suggests that their mode of action is indirect. Under conditions in which the late genes are transcribed (inefficiently) by the host
RNA polymerase
, gene 1.1 is observed to stimulate the synthesis of lysozyme (the product of a late phage gene). In contrast, when the late genes are transcribed by the phage-specified
RNA polymerase
(the product of gene 1), the kinetics of synthesis of the phage
RNA polymerase
itself, and of lysozyme, are not affected by the deletion of genes 0.3, 0.7, 1.1, and 1.3. We conclude that under these conditions, the products of these genes are required neither for regulation of expression of the late genes nor for the shutoff of early phage gene expression.
J Virol 1977
Sep
PMID:Roles of the early genes of bacteriophage T7 in shutoff of host macromolecular synthesis. 33 Aug 78
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>