Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.7.6 (
RNA polymerase
)
34,946
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Ambystoma mexicanum is an intriguing animal model for studying heart development because it carries a mutation in gene c.
Hearts
of homozygous recessive (c/c) mutant embryos do not contain organized myofibrils and fail to beat. However, the defect can be corrected by organ-culturing the mutant heart in the presence of RNA from anterior endoderm or RNA from endoderm mesoderm-conditioned medium. We constructed a cDNA library from total conditioned medium RNA in a pcDNAII expression vector. We screened the cDNA library by an organ culture bioassay and isolated a single clone (Cl#4), the synthetic RNA from which corrects the heart defect by promoting myofibrillogenesis. The insert size of the active clone is 166 nt in length with a unique nucleotide sequence. The anti-sense RNA from Cl#4 using SP6
RNA polymerase
failed to rescue mutant hearts. The ability of this small RNA to correct the mutant heart defect suggests that the RNA probably does not act as an mRNA. While the precise mechanism of action is not yet known, on the basis of our studies to date it is very clear that the sense strand of Cl#4 RNA has the ability to promote myofibrillogenesis and rescue the mutant hearts both in vitro and in vivo.
...
PMID:A specific synthetic RNA promotes cardiac myofibrillogenesis in the Mexican axolotl. 895 2
Activated pancreatic stellate cells (PSC) play a central role in the pathogenesis of pancreatic fibrosis, a common feature of chronic pancreatitis which is often caused by excessive alcohol consumption. In view of the central role of connective tissue growth factor (CCN2) in fibrosis, we investigated the mechanisms by which CCN2 is regulated in PSC following their exposure to ethanol or acetaldehyde. Primary cultures of PSC from Balb/c mice were treated with 0-50 mM ethanol or 0-200 microM acetaldehyde in the presence or absence of 4-methylpyrazole (4MP; an inhibitor of alcohol dehydrogenase), diallyl sulfide (
DAS
; an inhibitor of cytochrome P4502E1) or anti-oxidant catalase or vitamin D. CCN2 production, assessed by reverse-
transcriptase
polymerase chain reaction to measure CCN2 mRNA levels or by fluorescence activated cell sorting to assess CCN2 protein, was enhanced in a dose-dependent manner by ethanol or acetaldehyde. In the presence of 4MP,
DAS
, or the anti-oxidants vitamin D or catalase, there was a substantial decrease in the ability of ethanol to stimulate CCN2 mRNA expression and a concomitant decrease in CCN2-positive PSC. Accumulation of reactive oxygen species in PSC after exposure to ethanol was verified by loading the cells with dichlorofluorescin diacetate and showing that there was a stimulation of its oxidized fluorescent product, the latter of which was diminished in the presence of catalase or vitamin D. These results show the production of acetaldehyde and oxidant stress in mouse PSC are the cause of increased CCN2 mRNA and protein production after exposure of the cells to ethanol. The potential therapeutic effects of inhibitors of ethanol metabolism or anti-oxidants in alcoholic pancreatitis may arise in part through their ability to attenuate CCN2 production by PSC.
...
PMID:Ethanol-mediated expression of connective tissue growth factor (CCN2) in mouse pancreatic stellate cells. 1928 Apr 52
Apple chlorotic leaf spot virus (ACLSV) is the type species of the genus Trichovirus in the Betaflexiviridae family (1). ACLSV is distributed worldwide in most pome and stone fruit trees of the Rosaceae family, including apple, pear, peach, plum, cherry, apricot, and hawthorn (3). In 2012, a de novo assembly of the fruit transcriptome of a hawthorn (Crataegus pinnatifida) accession maintained in the National Hawthorn Germplasm Repository at Shenyang was conducted using Illumina-based RNA-seq data, and it resulted that a 7,543 nt of the genomic sequence of ACLSV was assembled. To confirm the result of Illumina RNA-Seq analysis, nine pairs of primers were designed according to the assembled sequence of ACLSV to amplify the genomic sequence of ACLSV by RT-PCR with total RNA extracted from hawthorn leaves as template (2). The full-length sequence of the isolate of ACLSV from hawthorn assembled with the sequences of the RT-PCR fragments was also 7,543 nt (GenBank Accession No. KM207212), which shows 99.5% nucleotide identity with the sequence assembled from Illumina RNA-seq data. The isolate of ACLSV from hawthorn was named SY01, which shows about 75% nucleotide identity with the sequences of ACLSV isolated from apple (GenBank Accession No. KJ522693), peach (JN634760), and plum (M58152). The nucleotide sequences of coat protein and
RNA polymerase
genes of SY01 are about 83 and 88% identical with those of ACLSV isolates in GenBank, respectively. A pair of primers HF/HR (ACCGGCGTCTTTTGCAAACT/TGGGTTCCAGAGTTTGAATGCA), which amplified a 210-bp fragment, was designed according to the sequence of SY01 to detect ACLSV in hawthorns. With RT-PCR, ACLSV was detected in 6 of the 30 accessions of hawthorn, and the nucleotide identity among PCR fragments was 92%. In addition, leaves from six RT-PCR positive plants reacted positively when tested by
DAS
-ELISA with polyclonal antisera (X-Y Biotechnology, Shanghai, China) raised against ACLSV. These findings, representing the first report of the presence of ACLSV in hawthorn in China, illustrate the need to develop virus-free trees of hawthorn for cultivation and germplasm distribution of this important Rosaceae family plant. References: (1) E. B. Carstens. Arch. Virol. 155:133, 2010. (2) H. Dai et al. PLoS ONE 8(9):e72910, 2013. (3) A. T. Katsiani et al. Plant Pathol. 63:63, 2014.
...
PMID:First Report of Apple chlorotic leaf spot virus in Hawthorn in China. 3069 56
Leek yellow stripe virus (LYSV), genus Potyvirus, family Potyviridae, infects a wide range of Allium species worldwide. LYSV is one of several viruses that chronically infect garlic, Allium sativum L. The garlic virus complex, which includes LYSV, Onion yellow dwarf virus, and Garlic common latent virus, is perpetuated by asexual propagation (4) and is transmitted to clean planting material by aphids (3). This virus complex can reduce garlic bulb weight by nearly three quarters (2), and LYSV-only infections can result in approximately a one-quarter reduction in bulb weight (2). Garlic is grown as a small-scale, specialty crop in Ohio. During late May and early June 2013, garlic plants with virus-like symptoms were collected from Medina, Holmes, and Wayne counties, Ohio. Plants exhibited chlorotic streaking, foliar dieback, dwarfing, small bulbs, and cylindrical bulbs that failed to differentiate into cloves. Incidence of affected plants in the fields was up to 5% and all fields had early season aphid infestations. Flexuous rods were observed in TEM micrographs of plant sap from symptomatic leaves. Five symptomatic plants and six asymptomatic plants (from fields with symptomatic plants) were evaluated for LYSV by
DAS
-ELISA (Agdia, Inc., Elkhart, IN). Reverse
transcriptase
(RT)-PCR with LYSV-specific primers LYSV-WA and LYSV-WAR (3) was performed with cDNA generated by the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Both foliar and bulb tissues were tested using both detection methods. Forty percent of symptomatic plants and 67% of asymptomatic plants tested positive for LYSV with both ELISA and RT-PCR. LYSV was detected in both foliar and bulb tissues, including both tissues from asymptomatic plants. Five PCR amplicons generated from both foliar and bulb tissue were sequenced and shown to share 96 to 98% maximum identity with an LYSV polyprotein gene accession in GenBank (AY842136). This provided additional support that the detected virus was LYSV. LYSV was initially difficult to detect in Ohio fields due to low disease incidence and subtle symptom development. Use of virus-tested garlic bulbs can improve yield for several years, even following viral reinfection by aphids, compared to growing garlic from chronically infected bulbs (1). However, many growers routinely save bulbs from year to year and lack access to or knowledge of virus-tested sources of garlic bulbs. Conducive conditions, chronic infections, or co-infections with other viruses enhance the severity of symptoms and yield loss (2). LYSV has previously been reported in garlic producing regions of the northwestern United States (3), and to our knowledge, this is the first report of LYSV in garlic in Ohio. References: (1) V. Conci et al. Plant Dis. 87:1411, 2003. (2) P. Lunello et al. Plant Dis. 91:153, 2008. (3) H. Pappu et al. Plant Health Progress 10, 2008. (4) L. Parrano et al. Phytopathol. Mediterr. 51:549, 2012.
...
PMID:First Report of Leek yellow stripe virus in Garlic in Ohio. 3070 1