Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.7.6 (RNA polymerase)
34,946 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.
...
PMID:The complete sequence of a unique RNA species synthesized by a DI particle of VSV. 21 97

Sendai virus and VSV minus strand genome RNAs, labeled specifically at their 3' ends with RNA ligase, were used as probes to detect leader RNA--that is, short transcripts (approximately 50 nucleotides) complementary to the exact 3' end of the minus strand genome. These probes have allowed the detection of plus strand leader RNAs in both Sendai virus and VSV-infected cells as well as in the virion transcriptase reactions. The use of a similar probe, prepared from the self-complementary ends of DI genome RNA and containing the 3' end of the plus strand antigenome RNA, has allowed the detection of a minus strand leader RNA of identical size in VSV-infected cells. Since the presence of DI genomes could not be detected by analytical sucrose gradient centrifugation in these VSV-infected cells, this minus strand leader RNA is apparently synthesized on the template formed by the exact 3' end of the antigenome RNA.
...
PMID:Plus and minus strand leader RNAs in negative strand virus-infected cells. 22 62

Infectious monomers of citrus exocortis viroid (CEV) were synthesized in vitro precisely to predetermined sequences in microgram quantities without resorting to cloning procedures. Amplification of CEV double-stranded cDNAs fused with a T7 RNA polymerase promoter was followed by transcription of the DNA resulting in the production of an infectious linear CEV monomer. This is the first demonstration of an infectious unit length viroid synthesized in vitro. Transcripts containing 3'-OH terminal groups were infectious, demonstrating that a 2',3'-cyclic phosphate terminus is not a prerequisite for viroid infectivity as previously suggested. Conversion of the 5'-triphosphate terminus to either 5'-monophosphate or 5'-OH had little effect on infectivity. The linear RNA could be circularized using T4 RNA ligase to produce an authentic CEV molecule. This procedure, which results in the production of biologically active RNA, would allow routine application of oligonucleotide-directed mutagenesis to the study of viroids and other circular RNAs. It would also enable the in vitro synthesis and mutagenesis of infectious viral RNAs containing a 5'-G residue.
...
PMID:In vitro synthesis of an infectious viroid: analysis of the infectivity of monomeric linear CEV. 172 98

Yeast tRNA ligase, from Saccharomyces cerevisiae, is one of the protein components that is involved in the splicing reaction of intron-containing yeast precursor tRNAs. It is an unusual protein because it has three distinct catalytic activities. It functions as a polynucleotide kinase, as a cyclic phosphodiesterase, and as an RNA ligase. We have studied the binding interactions between ligase and precursor tRNAs containing two photoreactive uridine analogues, 4-thiouridine and 5-bromouridine. When irradiated with long ultraviolet light, RNA containing these analogues can form specific covalent bonds with associated proteins. In this paper, we show that 4-thiouridine triphosphate and 5-bromouridine triphosphate were readily incorporated into a precursor tRNA(Phe) that was synthesized, in vitro, with bacteriophage T7 RNA polymerase. The analogue-containing precursor tRNAs were authentic substrates for the two splicing enzymes that were tested (endonuclease and ligase), and they formed specific covalent bonds with ligase when they were irradiated with long-wavelength ultraviolet light. We have determined the position of three major cross-links and one minor cross-link on precursor tRNA(Phe) that were located within the intron and near the 3' splice site. On the basis of these data, we present a model for the in vivo splicing reaction of yeast precursor tRNAs.
...
PMID:Binding interactions between yeast tRNA ligase and a precursor transfer ribonucleic acid containing two photoreactive uridine analogues. 285 71

The translational operator of the R17 replicase gene contains a bulged A residue that is essential for the specific binding to R17 coat protein. A large number of operator variants have been synthesized to more precisely examine the role of the bulged A residue on this specific protein-RNA interaction. By use of RNA ligase and transcription of synthetic DNA templates by T7 RNA polymerase, 14 different nucleotides were introduced to the bulged A position of three different coat protein binding fragments. The affinity between coat protein and each fragment was determined by a nitrocellulose filter binding assay. The data indicate that while functional groups on N1, C2, C6, N7, and 2'OH of the bulged A can be substituted without greatly changing protein binding, bulky substituents cannot be tolerated at these positions. Data from additional fragments that have base-pair changes adjacent to the bulged A suggest that the propensity of the bulged A to intercalate into the helix can affect protein binding.
...
PMID:Role of a bulged A residue in a specific RNA-protein interaction. 332 19

The binding sites for influenza viral RNA polymerase on genome RNA segments were investigated. Ribonucleoprotein (RNP) cores containing the RNA polymerase were isolated from detergent-treated virions by glycerol gradient centrifugation. On ApG-primed in vitro transcription by the isolated RNP cores, different levels of RNA transcripts were synthesized for the eight RNP cores, suggesting an uneven distribution of the RNA polymerase. 3'-Terminal labeling of the RNP cores with the use of [32P]pCp and T4-RNA ligase indicated a reciprocal correlation between the levels of the RNA-3' label and RNA synthesis. Centrifugation of detergent-treated virions in a double gradient of cesium trifluoroacetate (or cesium chloride) and glycerol yielded RNA polymerase-RNA complexes devoid of NP, the major RNA-bound protein, but the pattern of RNA-3' labeling remained virtually unaffected. All these observations together indicated that the RNA polymerase is associated near the 3' termini of some viral RNA segments, thereby preventing the in vitro labeling of the RNA-3' ends. The results of foot-printing experiments using RNase V1 and RNase T2 were in agreement with this model.
...
PMID:Identification of the RNA polymerase-binding site on genome RNA of influenza virus. 343 66

Bacteriophage lambda transcripts were synthesized in vitro using lambda b2 DNA and Escherichia coli RNA polymerase. RNA molecules initiating with ATP were labeled exclusively at the 5'-end by transcribing in the presence of [gamma-32P]ATP. They were analyzed by electrophoresis in 3.5% polyacrylamide, 7.5 M urea gels followed by autoradiography. The previously known 6 S rho-independent transcript and rho-dependent 9 S and 8 S transcripts were observed. A new rho-dependent 5 S transcript was also detected. The 5 S RNA was not the result of cleavage of larger RNAs by ribonuclease III. Analysis of partial ribonuclease T1 digestion products of isolated 5'-end-labeled transcripts showed that the 5 S RNA is synthesized from promoter pR, the promoter for the 9 S and 8 S RNA species. A similar analysis of transcripts labeled with 32P exclusively at the 3'-terminus by the post-transcriptional addition of a [32P]pCp moiety with T4 RNA ligase revealed the positions of guanosine nucleotides proximal to the 3'-hydroxyl end. This information, and inspection of the known DNA nucleotide sequence downstream from pr, allowed us to conclude that the 5 S RNA is a mixture of molecules 112 and 113 nucleotides long terminating in the middle of gene cro. The nucleotide sequence at the 3'-end of the 5 S RNA is similar to that of other rho-dependent transcripts and lacks the oligo(U) found at the terminus of rho-independent transcripts.
...
PMID:Characterization of a rho-dependent termination site within the cro gene of bacteriophage lambda. 644 59

The genetically defined human cytomegalovirus (HCMV) lytic-phase replicator, oriLyt, comprises more than 2 kb in a structurally complex region that spans a variety of potential transcription control signals. Several transcripts originate within or cross oriLyt, and we are studying these oriLyt transcription units to determine whether they participate in initiating or regulating lytic-phase DNA synthesis. Results presented here establish the temporal accumulation and structure of the smallest replicator transcript, which we call SRT, and identify a single-sequence element essential to replicator function. SRT was detected as early as 2 h after HCMV infection of human fibroblast cells; transcript levels increased by 24 h and continued to increase thereafter. Consistent with its early appearance, treatment of HCMV-infected cells with the viral DNA polymerase inhibitor phosphonoformic acid had no effect on SRT accumulation; however, no SRT was detected in RNA preparations from cycloheximide-treated infected cells. Additional Northern (RNA) analysis localized the 0.2- to 0.25-kb SRT to an apparently noncoding segment near the center of the oriLyt core region. Reverse transcriptase PCR (rapid amplification of cDNA 5' ends [5'-RACE]) identified a single 5' end. In transient-transfection assays, the sequence immediately upstream of SRT functioned as a promoter responsive to HCMV infection when placed upstream of a reporter gene, suggesting that SRT is the product of a discrete transcription unit. RNA ligase-mediated 3'-RACE showed that SRT is not polyadenylated and has heterogeneous 3' ends within a roughly 45-nucleotide window overlapping an oligopyrimidine sequence having counterparts in the lytic-phase replicators of several herpesviruses. Mutation of the oligopyrimidine element showed that it is essential to oriLyt replicator function; it is the only essential single-sequence HCMV oriLyt replicator element described to date. Collectively, the location of SRT near the center of the oriLyt core region, its early expression, its overlapping relationship with a sequence element essential to replicator function, and its similarities to replicator transcripts in other systems suggest the possibility that SRT plays a role in initiating or regulating HCMV lytic-phase DNA synthesis.
...
PMID:The variable 3' ends of a human cytomegalovirus oriLyt transcript (SRT) overlap an essential, conserved replicator element. 876 37

We describe a new protocol, which does not require (4S)UpG, for introducing (4S)U into specific sites in a pre-mRNA substrate. A 5'-half and a full-length RNA are first synthesized by phage RNA polymerase. p(4S)Up, which is derived from (4S)UpU and can therefore be 32P-labeled, is then ligated to the 3' end of the 5'-half RNA with T4 RNA ligase. The 3' phosphate of the ligated product is removed subsequently by CIP (calf intestinal alkaline phosphatase) to produce a 3'-OH group. The 3'-half RNA with a 5' phosphate is produced by site-specific RNase H cleavage of the full-length pre-mRNA directed by a 2'-O-methyl RNA-DNA chimera. The two half RNAs are then aligned with a bridging oligonucleotide and ligated with T4 DNA ligase. Our results show that 32P-p(4S)Up ligation to the 3' end of the 5'-half RNA is comparable to 32P-pCp ligation. Also, the efficiency of the bridging oligonucleotide-mediated two-piece ligation is quite high, approximately 30-50%. This strategy has been applied to the P120 pre-mRNA containing an AT-AC intron, but should be applicable to many other RNAs.
...
PMID:A new strategy for introducing photoactivatable 4-thiouridine ((4S)U) into specific positions in a long RNA molecule. 921 62

Availability of 4-thiouridine (4-thioU)-containing RNAs is the prerequisite for 4-thioU site-specific cross-linking studies. This paper presents a method for constructing such RNAs. A 5'- and a 3'-RNA are synthesized via phage RNA polymerase transcription and/or RNase H site-specific cleavage directed by 2'-O-methyl-RNA-DNA chimeras. These two half-RNAs in combination correspond to the sequence of full-length RNA, with a single nucleotide gap at the junction that will be filled in with a 4-thiouridylate. A single p4SUp, which is derived from 4SUpN (N can be any nucleotide) via 5'-phosphorylation (therefore, the phosphate can be radioactive) followed by RNase A digestion, is then ligated to the 3' end of the 5'-half RNA with T4 RNA ligase. The 3'-phosphate of the ligated product is subsequently removed by calf intestinal alkaline phosphatase to produce a 3'-hydroxyl group. The resulting 5'-half RNA and the 3'-half RNA with a 5'-phosphate group (which can also be radioactive) are then aligned with a bridging deoxyoligonucleotide and ligated with T4 DNA ligase. This method was previously applied to the P120 pre-mRNA that contains an AT-AC intron, yielding three RNAs each containing a single 4-thioU near the 5'-splice site. Subsequent cross-linking studies with these RNAs yielded detailed information regarding interactions between the 5'-splice site and other spliceosomal snRNAs and between the 5'-splice site and proteins during splicing. Because there is no sequence constraint surrounding the site of 4-thioU substitution, this method should be applicable to many other RNAs.
...
PMID:Construction of 4-thiouridine site-specifically substituted RNAs for cross-linking studies. 1020 12


1 2 3 Next >>