Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.7.6 (RNA polymerase)
34,946 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Transcription of the 26-kilobase (kb) dihydrofolate reductase (dhfr) gene in CHO cells is initiated at two sites: a major site (approximately 85% of the dhfr mRNA) at -63 relative to the translation start and a minor site (approximately 15%) at -107. Transcription also occurs from the opposite DNA strand in the dhfr 5' region, with a probable initiation site at approximately -195 relative to the dhfr translation start. A 4-kb polyadenylated RNA that is derived from the opposite-strand transcription increases threefold in abundance after serum starvation of CHO cells for 24 h. dhfr mRNA levels do not change during this time. The first dhfr exon lies within a 1-kb genomic region marked by exceptionally high G + C content and lack of DNA methylation. This region also includes a 214-base-pair (bp) exon for the opposite-strand transcript and five of the six DNase I-hypersensitive sites identified at the dhfr locus. Analysis of the DNA sequences of hamster, human (M. Chen, T. Shimada, A. D. Moulton, A. Cline, R. K. Humphries, J. Maizel, and A. W. Nienhuis, J. Biol. Chem. 259:3933-3943, 1984), and mouse (M. McGrogan, C. C. Simonsen, D. T. Smouse, P. J. Farnham, and R. T. Schimke, J. Biol. Chem. 260:2307-2314, 1985) dhfr genes reveals the presence of a 29-bp unit that is conserved 45 to 49 bp upstream of major and minor dhfr transcription start sites. This unit follows the consensus: GRGGCGGTGGCCTNNNNTGTCRCAARTRGGTR. The 5' part of the 29-bp unit contains a GC box that agrees with the GGGCGG consensus-binding site for the RNA polymerase II transcription factor Sp1 (D. Gidoni, W. A. Dynan, and R. Tjian, Nature (London) 312:409-413, 1984). Each of the three mammalian dhfr genes has several G-rich GC boxes proximal to the major dhfr transcription start site and several GC boxes of the opposite orientation (C rich) in a distal region about 500 bp upstream.
...
PMID:Multiple transcription start sites, DNase I-hypersensitive sites, and an opposite-strand exon in the 5' region of the CHO dhfr gene. 302 46

The initiator AUC of the mouse dihydrofolate reductase gene (dhfr) was converted to ACG by site-directed mutagenesis and assayed for expression in cultured monkey cells using an SV40 recombinant called SVGT5dhfr26m2. Synthesis of apparently full-length dihydrofolate reductase (DHFR) protein was significantly reduced compared to wild-type, but not entirely abolished, suggesting that the ACG triplet was being utilized for translation initiation. In addition, a truncated form of DHFR was produced, apparently by initiation at the next in-frame AUG downstream. This result was confirmed in vitro. Transcripts of the dhfr sequence were produced by SP6 RNA polymerase in the presence of m7GpppG and translated in vitro using reticulocyte lysates and wheat germ extracts. The results paralleled those observed in vivo. Synthesis of full-length DHFR was reduced, but not eliminated, and a new species was produced by initiation at an internal site. Amino acid sequence analysis of the products of in vitro translation demonstrated that translation does indeed initiate at the ACG triplet and that it initiates with methionine. Additional mutations were introduced which altered the sequence context of the ACG triplet. Mutation of the translation initiation consensus sequence by substitution of the A residue at position -3, or of the G at +4 resulted in a significant decrease in initiation at the ACG and an increase in the level of the internal initiation product. Thus, translation initiation at a non-AUG triplet depends on a favorable sequence context.
...
PMID:Translation initiation at an ACG triplet in mammalian cells. 304 Jul 20

We have previously shown by affinity chromatography that RAP30 and RAP74 are the mammalian proteins that have the highest affinity for RNA polymerase II. Here we show that RAP30 binds to RAP74 and that the RAP30-RAP74 complex (RAP30/74) is required for accurate initiation by RNA polymerase II. RAP30/74 is required for accurate transcription from the following promoters: the adenovirus major late promoter, the long terminal repeat of human immunodeficiency virus, P2 of the human c-myc gene, the mouse beta maj-globin promoter (all of which have TATA boxes), and the mouse dihydrofolate reductase promoter (which lacks a TATA box). RAP30/74 is not required for initiation by RNA polymerase III at the adenovirus virus-associated RNA promoters. Therefore, RAP30/74 is a general initiation factor that binds to RNA polymerase II.
...
PMID:RAP30/74: a general initiation factor that binds to RNA polymerase II. 338 90

The expression of a number of genes was measured in P1798 cells treated for various periods of time with 0.1 microM dexamethasone. Thymidine kinase (TK) activity decreased under these conditions with 50% inhibition achieved within approximately 8 h. Decreased TK activity was associated with reduced abundance of TK mRNA. Analysis of nuclear transcription indicated that this was attributable to a decrease in the number of RNA polymerase II molecules engaged in transcription of the TK gene. With respect to TK, there was an overall correlation between enzyme activity, mRNA, and nuclear transcription. The data are consistent with the hypothesis that glucocorticoid inhibition of expression of TK is primarily due to inhibition of transcription. Transcription of the TK gene was also reduced by greater than 90% after inhibition of protein synthesis for 6 h. This suggests that transcription of this gene requires a protein of short biological half-life. It is proposed that this hypothetical transcription factor is regulated by glucocorticoids. The amount of thymidylate synthase and dihydrofolate reductase remained constant for at least 24 h in dexamethasone-treated P1798 cells. Dihydrofolate reductase mRNA likewise remained constant. However, the mRNA encoding thymidylate synthase decreased 80-90% within 24 h. The mRNA encoding ornithine decarboxylase also decreased. In neither case did this appear to be primarily due to inhibition of transcription of the respective genes. The abundance of the mRNAs encoding hypozanthine-guanine phosphoribosyl transferase and phosphoglycerate kinase did not decrease in dexamethasone-treated cells.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Glucocorticoid regulation of the genes encoding thymidine kinase, thymidylate synthase, and ornithine decarboxylase in P1798 cells. 339 44

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.
...
PMID:Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element. 371 72

The processed pseudogenes reported to date fall into three categories: those that are a complete copy of the mRNA transcribed from the functional gene, those that are only a partial copy of the corresponding mRNA, and those that contain sequences in addition to those expected to be present in the mRNA. The general structural characteristics of these processed pseudogenes include the complete lack of intervening sequences found in the functional counterparts, a poly A tract at the 3' end, and direct repeats flanking the pseudogene sequence. In all the cases studied, these pseudogenes have been found to be on a different chromosome from their functional counterpart. These characteristics have led investigators to suggest that an RNA intermediate, in many cases the mRNA of the functional gene, is involved in the production of these pseudogenes. The mechanism by which processed pseudogenes arose involves the integration of the mRNA, or its cDNA copy, into a staggered chromosome break, followed by DNA synthesis and repair. I suggest that all the transcripts that gave rise to these pseudogenes were actually produced in the germ line cell. The transcripts that gave rise to the processed pseudogenes that are direct copies of the corresponding mRNA resulted from RNA polymerase II transcription of the functional counterpart. Pseudogenes that are not a direct copy of the corresponding mRNA may have resulted from RNA polymerase III transcription. If this is indeed the case, one need not postulate the involvement of retroviruses to explain the presence of processed pseudogenes corresponding to genes that are not expressed in the germ line. Following the integration event, processed pseudogenes can no longer be transcribed to produce the functional mRNA from which they arose. This inability to be transcribed by RNA polymerase II is not surprising considering that processed pseudogenes seem to be randomly integrated into the genome. Therefore, integration of a processed pseudogene such that RNA polymerase II transcriptional promoters are correctly positioned 5' to the resultant pseudogene is an unlikely event. The presence of processed pseudogenes seems peculiar to mammals. In fact, evolutionary studies indicate that processed pseudogenes are of relatively recent origin. In fact, at least one processed pseudogene, the human DHFR psi 1, has been formed so recently that it is polymorphic.
...
PMID:Processed pseudogenes: characteristics and evolution. 390 43

The growth of MCF-7 cells was arrested by 24 h of isoleucine deprivation. Following replenishment of the medium, the incorporation of uridine and thymidine into trichloroacetic acid-precipitable material began to increase slowly and gradually rose to the level of cycling cells. The addition of 5 X 10(-9) M estradiol to growth-arrested cells dramatically shortened the time of onset of macromolecular synthesis and increased the overall amount of precursor incorporation 2- to 4-fold over the level obtained by arrested control cells. The increase in uridine incorporation preceded the increase in thymidine incorporation by 6 h. Inhibition of protein synthesis with cycloheximide blocked the recovery of macromolecular synthesis in both control and estrogen-treated cells. Actinomycin D was ineffective in blocking the estrogen-stimulated recovery of macromolecular synthesis at concentrations known to inhibit pre-rRNA synthesis (10(-8) M). At higher concentrations, uridine and thymidine incorporation were inhibited in a dose-dependent manner. Inhibition of RNA polymerase II activity with alpha-amanitin similarly blocked both the recovery of the cells from isoleucine starvation and the potentiation of this by estradiol. Dihydrofolate reductase and thymidine kinase activities are both stimulated by estradiol in MCF-7 cells. In cycling cells, estrogen stimulates a 2-fold increase in their messenger RNAs (mRNAs) within 24 h. The level of dihydrofolate reductase mRNA is unaffected by isoleucine starvation, and estrogen caused no change in dihydrofolate reductase mRNA levels over a 24-h period following reversal of growth arrest. Similar results were observed for the 600-nucleotide pS2 mRNA that has been identified as an estrogen-induced RNA in MCF-7 cells. In contrast, thymidine kinase mRNA was found to be increased by estrogen at 24 h, but not at 12 h, following reversal of growth arrest. This increase correlates with increases in thymidine, but not uridine incorporation. These data indicate that the estrogen-stimulated increase in thymidine incorporation following release from growth arrest is dependent on new RNA synthesis. However, the hormone did not increase the levels of three estrogen-regulated mRNAs coordinately with the increases observed in uridine incorporation.
...
PMID:Relationship between the expression of estrogen-regulated genes and estrogen-stimulated proliferation of MCF-7 mammary tumor cells. 398 99

We have studied the rate of transcription of the gene for dihydrofolate reductase (DHFR) in mouse 3T6 fibroblasts during serum-induced transitions between the resting (G0) and growing states. As a model system, we have used a methotrexate-resistant 3T6 cell line that overproduces DHFR and its mRNA about 300-fold, yet regulates the expression of the DHFR gene in the same manner as normal 3T6 cells. In previous studies, we showed that the rate of production of cytoplasmic DHFR mRNA relative to total mRNA is about 4 times lower in resting than in exponentially growing cells. The rate increases to the growing value by about 15 hr following serum stimulation of the resting cells. This increase appeared to be controlled by regulating the rate of synthesis of DHFR hnRNA. In this study, we analyze the transcription of the DHFR gene in more detail. We use a variety of labeling times and RNA extraction procedures to measure the rate of synthesis of DHFR hnRNA relative to total hnRNA in pulse-labeled cells or in nuclei isolated from cells at various times following serum stimulation. The amount of labeled DHFR RNA is determined by DNA-excess filter hybridization. In all cases, the relative rate of synthesis of DHFR hnRNA increases at the same time, and to the same extent, as the rate of production of DHFR mRNA, suggesting that the increase in DHFR mRNA production is due to a corresponding increase in the rate of transcription of the DHFR gene. The increase in DHFR gene transcription is not blocked by cytosine arabinoside, showing that the increase does not depend on gene duplication. In isolated nuclei, DHFR RNA synthesis is inhibited by alpha-amanitin (1 microgram/ml), indicating that the DHFR gene is transcribed by RNA polymerase II. Others have shown that when stationary phase cells are stimulated to proliferate, the increase in DHFR mRNA content is controlled primarily at the post-transcriptional level. Therefore, it appears that the rate of production of DHFR mRNA is controlled by different biochemical mechanisms when cells are in different physiological states.
...
PMID:In vitro and in vivo analysis of the control of dihydrofolate reductase gene transcription in serum-stimulated mouse fibroblasts. 669 Apr 54

Recently, it has been demonstrated that nitrogen mustard-induced N-alkylpurines are excised rapidly from actively transcribing genes, while they persist longer in noncoding regions and in the genome overall. It was suggested that transcriptional activity is implicated as a regulatory element in the efficient removal of lesions. By treating cells or not with the transcription inhibitor alpha-amanitin, we have explored whether ongoing activity of RNA polymerase II was coordinately related to proficient repair of nitrogen mustard-induced alkylation products in the actively transcribed dihydrofolate reductase gene in the Chinese hamster ovary B11 cells. Nuclear run-off transcription analysis verified that alpha-amanitin completely and selectively inhibited transcription by RNA polymerase II. At the drug exposure examined, nitrogen mustard induced DNA damage capable of a complete transcription termination in the RNA polymerase II-transcribed dihydrofolate reductase gene and reduced 28S rDNA transcription by a factor of 7.9. The transcription activity did partially recover following reincubation in drug-free medium; this recovery was about 34 and 76% of ribosomal 28S gene transcripts and dihydrofolate reductase gene transcripts, respectively, after 6 h of repair incubation. alpha-Amanitin significantly inhibited the removal of nitrogen mustard-induced N-alkylpurines in the 5'-half of the essential, constitutively active dihydrofolate reductase gene, while no effect of alpha-amanitin was observed on the lesion removal from a noncoding region 3'-flanking to the gene and from the genome overall. In the actively transcribed gene region, about 77% of N-alkylpurines were removed 21 h following drug exposure of cells not treated with alpha-amanitin and about 47% in 21 h in alpha-amanitin treated cells. The global semiconservative replication seemed unaffected by the alpha-amanitin treatment. From these results we suggest that gene-specific repair of nitrogen mustard-induced N-alkylpurines is dependent on ongoing activity of the transcribing RNA polymerase II. The findings are discussed in terms of the current ideas about the mechanism of preferential DNA repair.
...
PMID:Ongoing activity of RNA polymerase II confers preferential repair of nitrogen mustard-induced N-alkylpurines in the hamster dihydrofolate reductase gene. 750 96

Previous studies have demonstrated transcription-coupled DNA repair in mammalian genes transcribed by RNA polymerase II but not in ribosomal RNA genes (rDNA), which are transcribed by RNA polymerase I. The removal of UV-induced cyclobutane pyrimidine dimers (CPD) from rDNA in repair-proficient human cells has been shown to be slow but detectable and apparently not coupled to transcription. We studied the induction and removal of CPD from rDNA in cultured cells from two repair-deficient human disorders. Primary xeroderma pigmentosum complementation group C (XP-C) cells, whether proliferating or nondividing, removed no CPD from either rDNA strand in 24 h post-UV, a result which supports earlier conclusions that XP-C cells lack the general, transcription-independent pathway of nucleotide excision repair. We also observed lower than normal repair of rDNA in Cockayne's syndrome (CS) cells from complementation groups A and B. In agreement with previous findings, the repair of both strands of the RNA polymerase II-transcribed dihydrofolate reductase gene was also deficient relative to that of normal cells. This strongly suggests that the defect in CS cells is not limited to a deficiency in a transcription-repair coupling factor. Rather, the defect may interfere with the ability of repair proteins to gain access to all expressed genes.
...
PMID:Repair in ribosomal RNA genes is deficient in xeroderma pigmentosum group C and in Cockayne's syndrome cells. 751 88


<< Previous 1 2 3 4 5 6 7 Next >>