Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.7.7.6 (RNA polymerase)
34,946 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Some aspects of the regulation of alpha-amylase synthesis in Bacillus licheniformis CCM 2205 were investigated. The effect of actinomycin D and chloramphenicol was studied at the level of RNA transcription and translation. alpha-amylase synthesis in Bacillus licheniformis CCM 2205 was practically not altered during the first 20 min after the addition of actinomycin D, although RNA synthesis was almost completely blocked. In contrast to RNA polymerase inhibitor, chloramphenicol stopped immediately the synthesis of alpha-amylase. By using the least squares method the mean half-life of alpha-amylase mRNA was calculated to range from 7.5 to 8.4 min. the mean half-life of cell protein mRNA was determined to range from 2.6 to 3.8 min. Having in mind the immediate effect of chloramphenicol on the alpha-amylase synthesis, it can be concluded that de novo protein synthesis is required in the case of actinomycin D resistant residual synthesis.
...
PMID:Functional half-life of the alpha-amylase mRNA of Bacillus licheniformis. 246 58

The alpha-amylase-coding gene (amy) of Bacillus amyloliquefaciens NCP1 was cloned into the Bacillus subtilis promoter probe vector pPL603b.1, using a BglII digest of chromosomal DNA. The resulting plasmid, pVC102, was shown to have a BglII site within the insert. It was determined that this was the result of the fortuitous co-cloning of 2.88-kb and 0.92-kb BglII fragments separated in NCP1 DNA by approx. 3 kb. Unexpectedly, this co-cloning was readily repeated. Subcloning showed that while the 2.88-kb amy-bearing fragment was sufficient for amylase production, it might not have been capable of promoting sufficient levels of chloramphenicol resistance under the conditions used in the cloning experiments. The promoter on the 0.92-kb BglII fragment was more efficient, although its sequence differed from the canonical promoter sequence recognised by B. subtilis RNA polymerase E.sigma 43. As other promoter-bearing fragments from NCP1 DNA operated equally efficiently when cloned into pPL603b.1, the reason for the repeated co-cloning of the 2.88-kb and 0.92-kb NCPI BglII fragments may well be due to structural parameters, whereby certain nucleotide sequences are more readily cloned than others.
...
PMID:Investigation into the nature of a Bacillus promoter cloned into a promoter-probe plasmid. 280 9

The genes encoding the major cell wall proteins, middle wall protein and outer wall protein, of Bacillus brevis 47 constitute a cotranscriptional unit (cwp [cell wall protein gene] operon). Primer extension assay of cwp operon transcripts showed the existence of six different 5' ends. This confirmed the results of the previous S1 nuclease protection assay and suggested the existence of several tandemly arranged promoters in the 5' region of the cwp operon. Promoter probe vectors carrying the Bacillus licheniformis alpha-amylase gene were constructed and used for deletion analysis of the 5' region. Three (P1, P2, and P3) of the six suggested promoters were shown to be located within three distinct fragments derived from the 5' region. The -35 and -10 regions of the P1 and P3 promoters resemble the consensus sequence recognized by the sigma-43-type RNA polymerase of Bacillus subtilis. The P2 promoter resembles only the consensus sequence in the -10 region. The P1 and P3 promoters were used to the same extents in Bacillus subtilis as in B. brevis, whereas the P2 promoter was used much less frequently in B. subtilis than in B. brevis. The P2 promoter is used constitutively in B. brevis 47 at all stages of growth, whereas P3 is used only at the exponential phase of growth. P2 could be a promoter of an unknown type that is preferentially used in B. brevis and might be responsible for the constitutive synthesis and secretion of the cell wall proteins into the medium at the stationary phase of growth.
...
PMID:Multiple and tandemly arranged promoters of the cell wall protein gene operon in Bacillus brevis 47. 291 62

The amyR1 locus controls the regulated transcription of amyE, the structural gene encoding alpha-amylase in Bacillus subtilis. Transcription of amyE is activated in early stationary phase cells, and can be repressed by rapidly metabolized carbon sources such as glucose. Transcription of amyE initiates in vitro from a promoter recognized by the major vegetative form of RNA polymerase, E sigma 43. S1 nuclease mapping of in-vivo amylase transcripts suggests that this promoter is also used in vivo. Two independently isolated cis-acting mutations, gra-5 and gra-10, which abolish glucose-mediated repression of amylase synthesis without altering temporal activation, were determined by DNA sequencing to result from a G.C to A.T transition at a position located five base-pairs downstream from the start site of transcription. While this is the first example of a site involved in catabolite repression of gene expression in a Gram-positive micro-organism, the region surrounding the gra mutations shows considerable homology to certain cis-acting regulatory loci in Escherichia coli, suggesting that such sequences have been evolutionarily conserved.
...
PMID:Catabolite repression-resistant mutations of the Bacillus subtilis alpha-amylase promoter affect transcription levels and are in an operator-like sequence. 312 1

Eukaryotic messenger RNAs are translated with unequal efficiencies in vivo and in vitro and the molecular basis of this phenomenon is not understood. As an approach to understanding the role of the 5' untranslated leader sequence in regulating mRNA translational efficiency, chimaeric mRNAs have been generated by joining a heterologous leader to complementary DNA (cDNA) sequences, followed by in vitro transcription using SP6 RNA polymerase and in vitro protein synthesis. We used the untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4), a well-translated, highly competitive message, to replace the leader sequence of barley alpha-amylase (B alpha A) and human interleukin 1 beta (IL-1 beta) cDNAs. Deletion of transcribed vector sequences and replacement of the native untranslated region with the AMV RNA 4 leader can result in as much as a 35-fold increase in mRNA translational efficiency; moreover, the translational efficiency of the chimaeric mRNAs containing the AMV RNA 4 leader is at least as great as that of virion RNA 4. The results suggest that the chimaeric AMV-mRNAs have either a higher relative affinity or a diminished requirement for a limiting component(s) of the translational machinery; in addition, it may be feasible, through use of heterologous leader sequences, to increase expression of engineered genes or cDNAs without changing the antigenic or biological properties of the encoded protein.
...
PMID:Enhanced translation of chimaeric messenger RNAs containing a plant viral untranslated leader sequence. 349 77

The nucleotide sequence of the promotor and NH2-terminal signal peptide region of the alpha-amylase gene derived from the alpha-amylase hyperproducing strain B. subtilis NA64 was determined. DNA sequences of the NH2-terminal region of the mature alpha-amylase, 41 amino acid residues of the signal peptide, a Shine-Dalgarno sequence (AGGAG), a potential RNA polymerase recognition site (TTGAAA), and a potential Pribnow box (AAGTAA) were identified. The DNA sequence was quite different from that of the alpha-amylase gene of B. amyloliquefaciens.
...
PMID:Nucleotide sequence of the promoter and NH2-terminal signal peptide region of Bacillus subtilis alpha-amylase gene cloned in pUB110. 618 86

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.
...
PMID:Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences. 641 92

The wheat kernel CM16 protein, a subunit of the heterotetrameric insect alpha-amylase inhibitor that has been involved in the technological quality of wheat-products, was produced in Escherichia coli. Cloning of the cDNA part encoding the mature protein in a pET expression plasmid, under the control of a promoter for the bacteriophage T7 RNA polymerase, allows the synthesis of large amounts of the CM16 protein in the bacteria. Upon induction with isopropyl thiogalactopyranoside the recombinant protein accumulates in insoluble inclusion bodies. Solubilization with 6 M urea containing 0.5 mM dithiothreitol, followed by slow elimination of the denaturing agents by step dialysis, results in a significant recovery of the recombinant protein in a soluble, monomeric form. Characterization of the protein was done by automated Edman degradation and total amino acid determination. The recombinant protein in comparison with the one isolated from wheat exhibits a Met extension at the N-terminus that was introduced in the construction for translation initiation. The CM16 protein produced in this manner has the advantage over wheat purified protein of not being contaminated with other proteins from the same family and constitutes adequate material for further analysis of the technological properties of the protein in wheat-derived products.
...
PMID:Expression of a cDNA encoding the wheat CM16 protein in Escherichia coli. 795 Mar 64

The amy gene of Streptomyces griseus was not expressed in Escherichia coli cells due to the lack of recognition of the amy promoter by the E. coli RNA polymerase, as confirmed by using promoter-probe vectors. The expression of the amy gene in E. coli was detected only when the promoter-less gene was placed under the control of the lacZ promoter and was dependent on the level of IPTG added to the medium. The extracellular alpha-amylase detected in the culture broth seems to be released by cellular lysis. When the amy gene lacking both leader peptide and promoter was transcribed from the lacZ promoter, no alpha-amylase activity was detected but larger E. coli cells and inclusion bodies were observed.
...
PMID:Expression of the Streptomyces griseus alpha-amylase gene in Escherichia coli. 802 Jul 51

The adaptation and application of the Escherichia coli T7 RNA polymerase system for regulated and promoter-specific gene expression in Bacillus subtilis is reported. The expression cassette used in Bacillus subtilis was tightly regulated and T7 RnA polymerase (T7 RNAP)appeared 30 minutes after induction. The efficiency of T7 promoter-specific gene expression in B.subtilis was studied using one secretory and two cytosolic proteins of heterologous origin. The accumulation of E. coli beta-galactosidase, as well as a 1,4-beta-glucosidase from Thermoanaerobacter brockii in B. subtilis after T7 RNAP induction was strongly enhanced by rifampicin inhibition of host RNAP activity. The alpha-amylase of Thermactinomyces vulgaris, a secretory protein, was found to accumulate in the culture supernatant up to levels of about 70 mg/l 10-20 h after T7 RNAP induction, but was also deposited in cellular fractions. The addition of rifampicin inhibited chi-amylase secretion, but unexpectedly, after a short period, also prevented its further (intra)cellular accumulation.
...
PMID:A T7 promoter-specific, inducible protein expression system for Bacillus subtilis. 862 23


1 2 Next >>

---