Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.7.7.6 (RNA polymerase)
34,946 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

We have previously shown by affinity chromatography that RAP30 and RAP74 are the mammalian proteins that have the highest affinity for RNA polymerase II. Here we show that RAP30 binds to RAP74 and that the RAP30-RAP74 complex (RAP30/74) is required for accurate initiation by RNA polymerase II. RAP30/74 is required for accurate transcription from the following promoters: the adenovirus major late promoter, the long terminal repeat of human immunodeficiency virus, P2 of the human c-myc gene, the mouse beta maj-globin promoter (all of which have TATA boxes), and the mouse dihydrofolate reductase promoter (which lacks a TATA box). RAP30/74 is not required for initiation by RNA polymerase III at the adenovirus virus-associated RNA promoters. Therefore, RAP30/74 is a general initiation factor that binds to RNA polymerase II.
...
PMID:RAP30/74: a general initiation factor that binds to RNA polymerase II. 338 90

The expression of a number of genes was measured in P1798 cells treated for various periods of time with 0.1 microM dexamethasone. Thymidine kinase (TK) activity decreased under these conditions with 50% inhibition achieved within approximately 8 h. Decreased TK activity was associated with reduced abundance of TK mRNA. Analysis of nuclear transcription indicated that this was attributable to a decrease in the number of RNA polymerase II molecules engaged in transcription of the TK gene. With respect to TK, there was an overall correlation between enzyme activity, mRNA, and nuclear transcription. The data are consistent with the hypothesis that glucocorticoid inhibition of expression of TK is primarily due to inhibition of transcription. Transcription of the TK gene was also reduced by greater than 90% after inhibition of protein synthesis for 6 h. This suggests that transcription of this gene requires a protein of short biological half-life. It is proposed that this hypothetical transcription factor is regulated by glucocorticoids. The amount of thymidylate synthase and dihydrofolate reductase remained constant for at least 24 h in dexamethasone-treated P1798 cells. Dihydrofolate reductase mRNA likewise remained constant. However, the mRNA encoding thymidylate synthase decreased 80-90% within 24 h. The mRNA encoding ornithine decarboxylase also decreased. In neither case did this appear to be primarily due to inhibition of transcription of the respective genes. The abundance of the mRNAs encoding hypozanthine-guanine phosphoribosyl transferase and phosphoglycerate kinase did not decrease in dexamethasone-treated cells.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Glucocorticoid regulation of the genes encoding thymidine kinase, thymidylate synthase, and ornithine decarboxylase in P1798 cells. 339 44

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.
...
PMID:Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element. 371 72

The growth of MCF-7 cells was arrested by 24 h of isoleucine deprivation. Following replenishment of the medium, the incorporation of uridine and thymidine into trichloroacetic acid-precipitable material began to increase slowly and gradually rose to the level of cycling cells. The addition of 5 X 10(-9) M estradiol to growth-arrested cells dramatically shortened the time of onset of macromolecular synthesis and increased the overall amount of precursor incorporation 2- to 4-fold over the level obtained by arrested control cells. The increase in uridine incorporation preceded the increase in thymidine incorporation by 6 h. Inhibition of protein synthesis with cycloheximide blocked the recovery of macromolecular synthesis in both control and estrogen-treated cells. Actinomycin D was ineffective in blocking the estrogen-stimulated recovery of macromolecular synthesis at concentrations known to inhibit pre-rRNA synthesis (10(-8) M). At higher concentrations, uridine and thymidine incorporation were inhibited in a dose-dependent manner. Inhibition of RNA polymerase II activity with alpha-amanitin similarly blocked both the recovery of the cells from isoleucine starvation and the potentiation of this by estradiol. Dihydrofolate reductase and thymidine kinase activities are both stimulated by estradiol in MCF-7 cells. In cycling cells, estrogen stimulates a 2-fold increase in their messenger RNAs (mRNAs) within 24 h. The level of dihydrofolate reductase mRNA is unaffected by isoleucine starvation, and estrogen caused no change in dihydrofolate reductase mRNA levels over a 24-h period following reversal of growth arrest. Similar results were observed for the 600-nucleotide pS2 mRNA that has been identified as an estrogen-induced RNA in MCF-7 cells. In contrast, thymidine kinase mRNA was found to be increased by estrogen at 24 h, but not at 12 h, following reversal of growth arrest. This increase correlates with increases in thymidine, but not uridine incorporation. These data indicate that the estrogen-stimulated increase in thymidine incorporation following release from growth arrest is dependent on new RNA synthesis. However, the hormone did not increase the levels of three estrogen-regulated mRNAs coordinately with the increases observed in uridine incorporation.
...
PMID:Relationship between the expression of estrogen-regulated genes and estrogen-stimulated proliferation of MCF-7 mammary tumor cells. 398 99

We have studied the rate of transcription of the gene for dihydrofolate reductase (DHFR) in mouse 3T6 fibroblasts during serum-induced transitions between the resting (G0) and growing states. As a model system, we have used a methotrexate-resistant 3T6 cell line that overproduces DHFR and its mRNA about 300-fold, yet regulates the expression of the DHFR gene in the same manner as normal 3T6 cells. In previous studies, we showed that the rate of production of cytoplasmic DHFR mRNA relative to total mRNA is about 4 times lower in resting than in exponentially growing cells. The rate increases to the growing value by about 15 hr following serum stimulation of the resting cells. This increase appeared to be controlled by regulating the rate of synthesis of DHFR hnRNA. In this study, we analyze the transcription of the DHFR gene in more detail. We use a variety of labeling times and RNA extraction procedures to measure the rate of synthesis of DHFR hnRNA relative to total hnRNA in pulse-labeled cells or in nuclei isolated from cells at various times following serum stimulation. The amount of labeled DHFR RNA is determined by DNA-excess filter hybridization. In all cases, the relative rate of synthesis of DHFR hnRNA increases at the same time, and to the same extent, as the rate of production of DHFR mRNA, suggesting that the increase in DHFR mRNA production is due to a corresponding increase in the rate of transcription of the DHFR gene. The increase in DHFR gene transcription is not blocked by cytosine arabinoside, showing that the increase does not depend on gene duplication. In isolated nuclei, DHFR RNA synthesis is inhibited by alpha-amanitin (1 microgram/ml), indicating that the DHFR gene is transcribed by RNA polymerase II. Others have shown that when stationary phase cells are stimulated to proliferate, the increase in DHFR mRNA content is controlled primarily at the post-transcriptional level. Therefore, it appears that the rate of production of DHFR mRNA is controlled by different biochemical mechanisms when cells are in different physiological states.
...
PMID:In vitro and in vivo analysis of the control of dihydrofolate reductase gene transcription in serum-stimulated mouse fibroblasts. 669 Apr 54

Recently, it has been demonstrated that nitrogen mustard-induced N-alkylpurines are excised rapidly from actively transcribing genes, while they persist longer in noncoding regions and in the genome overall. It was suggested that transcriptional activity is implicated as a regulatory element in the efficient removal of lesions. By treating cells or not with the transcription inhibitor alpha-amanitin, we have explored whether ongoing activity of RNA polymerase II was coordinately related to proficient repair of nitrogen mustard-induced alkylation products in the actively transcribed dihydrofolate reductase gene in the Chinese hamster ovary B11 cells. Nuclear run-off transcription analysis verified that alpha-amanitin completely and selectively inhibited transcription by RNA polymerase II. At the drug exposure examined, nitrogen mustard induced DNA damage capable of a complete transcription termination in the RNA polymerase II-transcribed dihydrofolate reductase gene and reduced 28S rDNA transcription by a factor of 7.9. The transcription activity did partially recover following reincubation in drug-free medium; this recovery was about 34 and 76% of ribosomal 28S gene transcripts and dihydrofolate reductase gene transcripts, respectively, after 6 h of repair incubation. alpha-Amanitin significantly inhibited the removal of nitrogen mustard-induced N-alkylpurines in the 5'-half of the essential, constitutively active dihydrofolate reductase gene, while no effect of alpha-amanitin was observed on the lesion removal from a noncoding region 3'-flanking to the gene and from the genome overall. In the actively transcribed gene region, about 77% of N-alkylpurines were removed 21 h following drug exposure of cells not treated with alpha-amanitin and about 47% in 21 h in alpha-amanitin treated cells. The global semiconservative replication seemed unaffected by the alpha-amanitin treatment. From these results we suggest that gene-specific repair of nitrogen mustard-induced N-alkylpurines is dependent on ongoing activity of the transcribing RNA polymerase II. The findings are discussed in terms of the current ideas about the mechanism of preferential DNA repair.
...
PMID:Ongoing activity of RNA polymerase II confers preferential repair of nitrogen mustard-induced N-alkylpurines in the hamster dihydrofolate reductase gene. 750 96

Previous studies have demonstrated transcription-coupled DNA repair in mammalian genes transcribed by RNA polymerase II but not in ribosomal RNA genes (rDNA), which are transcribed by RNA polymerase I. The removal of UV-induced cyclobutane pyrimidine dimers (CPD) from rDNA in repair-proficient human cells has been shown to be slow but detectable and apparently not coupled to transcription. We studied the induction and removal of CPD from rDNA in cultured cells from two repair-deficient human disorders. Primary xeroderma pigmentosum complementation group C (XP-C) cells, whether proliferating or nondividing, removed no CPD from either rDNA strand in 24 h post-UV, a result which supports earlier conclusions that XP-C cells lack the general, transcription-independent pathway of nucleotide excision repair. We also observed lower than normal repair of rDNA in Cockayne's syndrome (CS) cells from complementation groups A and B. In agreement with previous findings, the repair of both strands of the RNA polymerase II-transcribed dihydrofolate reductase gene was also deficient relative to that of normal cells. This strongly suggests that the defect in CS cells is not limited to a deficiency in a transcription-repair coupling factor. Rather, the defect may interfere with the ability of repair proteins to gain access to all expressed genes.
...
PMID:Repair in ribosomal RNA genes is deficient in xeroderma pigmentosum group C and in Cockayne's syndrome cells. 751 88

The C-terminal domain (CTD) of RNA polymerase II (RNAP II) is essential for the assembly of RNAP II into preinitiation complexes on some promoters such as the dihydrofolate reductase (DHFR) promoter. In addition, during the transition from a preinitiation complex to a stable elongation complex, the CTD becomes heavily phosphorylated. In this report, interactions involving the CTD have been examined by protein-protein cross-linking. As a prelude to the study of CTD interactions, the effect of recombinant CTD on in vitro transcription was examined. The presence of recombinant CTD inhibits in vitro transcription from both the DHFR and adenovirus 2 major late promoters, suggesting that the CTD is involved in essential interactions with a general transcription factor(s). Factors in the transcription extract that interact with the CTD were identified by protein-protein cross-linking. Recombinant CTD was phosphorylated at its casein kinase II site, at the C terminus of the CTD, in the presence of [35S]adenosine 5'-O-(thiotriphosphate) and alkylated with azidophenacyl bromide. Incubation of azido-modified 35S-labeled CTD with a HeLa transcription extract followed by ultraviolet irradiation results in the covalent cross-linking of the CTD to proteins in contact with the CTD at the time of irradiation. Subsequent incubation with phenylmercuric acetate results in the transfer of 35S from the CTD to the protein to which it was cross-linked. The two major photolabeled bands have a M(r) of 34,000 and 74,000. The specificity of CTD interactions was demonstrated by a reduction in photolabeling in the presence of unmodified CTD or RNAP II containing an intact CTD (RNAP IIA) but not in the presence of a CTD-less RNAP II (RNAP IIB). The 35S-labeled 34- and 74-kDa proteins comigrate on SDS-polyacrylamide gel electrophoresis with the beta subunit of transcription factor IIE and the 74-kDa subunit of transcription factor IIF, respectively. Moreover, some of the minor 35S-labeled bands comigrate with other subunits of the general transcription factors.
...
PMID:The photoactivated cross-linking of recombinant C-terminal domain to proteins in a HeLa cell transcription extract that comigrate with transcription factors IIE and IIF. 755 97

An array of tandem heptapeptide repeats at the carboxy-terminal domain (CTD) of the largest subunit of RNA polymerase II constitute a highly conserved structure essential for viability. Studies have established that the CTD is phosphorylated at different stages of the transcription cycle, and that it may be involved in transcriptional regulation. The exact role of the CTD remains elusive, as in vitro reconstituted transcription using the adenovirus major late promoter does not require the CTD. Previous studies showed that transcription from the murine dihydrofolate reductase (DHFR) promoter can be only accomplished by the form of RNA polymerase II that contains the hypophosphorylated CTD (RNAPIIA), but not by the form that lacks it (RNAPIIB). Here we show that the CTD, but not its phosphorylation, is required for initiation of transcription. We also show that transcription requires CTD kinase activity provided by the CDK subunit of TFIIH.
...
PMID:Requirement for TFIIH kinase activity in transcription by RNA polymerase II. 756 58

Two efficient systems have been used for high-level expression of Lactobacillus casei dihydrofolate reductase in Escherichia coli, including the production of protein generally and specifically labeled with 13C and 15N. A system based on T7 RNA polymerase led to the production of dihydrofolate reductase at a level of 37% of the total soluble protein of the host strain: 50 mg of pure enzyme was obtained from a 1 liter of culture (or 14 mg/g wet weight of cells). In this system, a small amount of the enzyme (less than 5%) was identified as a catalytically active 21-kDa fusion protein. Introduction of a second in-frame (ochre) stop codon did not eliminate the production of this fusion protein. The same expression system was also used to prepare dihydrofolate reductase generally labeled with 15N and to prepare single and double mutants of the enzyme. In order to have an expression system which can be used with a range of auxotrophic strains of E. coli, a system based on the tac promoter was used. This led to the production of dihydrofolate reductase at a level of 29% of total soluble protein; a yield of 40 mg enzyme per liter of culture (or 11 mg/g wet weight of cells). This system was successfully used to produce mutants of the enzyme as well as the enzyme selectively labeled with [gamma-13C]aspartic acid.
...
PMID:High-level expression and isotopic labeling of Lactobacillus casei dihydrofolate reductase for nuclear magnetic resonance spectroscopy. 766 56


<< Previous 1 2 3 4 5 6 Next >>

---