Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.7.6 (RNA polymerase)
34,946 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The smallest size class of mRNA (12S) synthesized in vitro by the virion-associated RNA polymerase of vesicular stomatitis virus contains two mRNA species of similar molecular weight that code for the viral M and NS proteins. The resolution of these mRNA species was achieved by converting them to duplexes by annealing with the genome RNA, followed by RNase T2 treatment and separation in a polyacrylamide gel. Using this separation technique, the mRNA's were identified by comparing the relative resistance of their syntheses to UV irradiation of the virus. The molecular weights of these two mRNA species calculated as duplex RNAs were smaller than expected. The possible reasons for this discrepancy are discussed.
...
PMID:Characterization of vesicular stomatitis virus mRNA species synthesized in vitro. 19 37

We established previously that the temperature-dependent host range mutant, td CE 3, of vesicular stomatitis virus (VSV) New Jersey possesses temperature-sensitive RNA transcriptase activity. In this paper, we describe dissociation and reconstitution experiments designed to determine which VSV polypeptide is affected by the td CE 3 mutation. Wild-type VSV New Jersey (ts+), the temperature-dependent host range mutant (td CE 3), and the revertant of this mutant (td CE/R1) were used. Transcribing nucleoprotein preparations, isolated from purified virus particles, were treated in the presence of digitonin with either 0.9 M LiCl to produce supernatants containing virtually only the L polypeptide or 2.0 M LiCl to produce ribonucleoprotein pellets containing only the polypeptides N and NS. Supernatant and pellet fractions synthesized either no or only trace amounts of RNA in vitro. Reconstitution of the supernatants with the pellets in all combinations at 31 degrees C restored much of the transcriptase activity of the transcribing nucleoprotein preparations. RNA synthesis occurred at 39 degrees C when the three pellets were reconstituted with wild-type and revertant supernatants. However, supernatant of the mutant td CE 3 reconstituted with any of the three pellets resulted in little or no detectable transcriptase activity at 39 degrees C. This implies that the polypeptide affected by the td CE 3 mutation is the L polypeptide.
...
PMID:Temperature-dependent host range mutation in vesicular stomatitis virus affecting polypeptide L. 19 60

A defective interfering particle derived from the heat-resistant strain of vesicular stomatitis virus was analyzed for the presence of virion-associated RNA polymerase (nucleosidetriphosphate:RNA nucleotidyltransferase, EC 2.7.7.6) activtiy. The RNA synthesizing capacity of the defective particles in vitro was similar to that of the wild-type virus. Characterization of the RNA produced in vitro indicated that the defective particles were able to synthesize vesicular stomatitis virus leader RNA and four virus mRNA species that sediment at 12-18 S. These RNA products were identical to the mRNAs synthesized in vitro by the wild-type virus in regard to size, polyadenylation, capping, and methylation. In contrast to the wild-type virus, the purified defective particles did not synthesize the large mRNA species sedimenting at 31 S in vitro. Possible mechanisms of homotypic and heterotypic interferences shown by this defective particle are discussed.
...
PMID:In vitro synthesis of messenger RNA by a defective interfering particle of vesicular stomatitis virus. 19 41

The RNA-dependent RNA polymerase associated with vesicular stomatitis virus has been found to be markedly inhibited at high concentrations of virus. This endogenous inhibitor of the virion transcriptase was completely reversed by the action of two negatively charged polyamino acids: poly(L-glutamic acid) and pepsin (EC 3.4.23.1). Two other polyanions, heparin and polyethylene sulfonate, strongly inhibited the activity of the virion transcriptase even at low virus concentrations. Poly (L-glutamic acid) rapidly released the block in transcription of concentrated vesicular stomatitis virus, possibly owing to competition for binding sites of the inhibitor on the virion nucleocapsid transcription complex.
...
PMID:Reversal by certain polyanions of an endogenous inhibitor of the vesicular stomatitis virus-associated transcriptase. 20 38

The in vitro RNA synthesis by the virion-associated RNA polymerase of vesicular stomatitis virus (VSV), New Jersey serotype, was compared with that of the serologically distinct Indiana serotype of VSV. The New Jersey serotype of VSV synthesized five distinct mRNA species in vitro, three of which were smaller than the corresponding species synthesized by the Indiana serotype of VSV. These included the mRNA's coding for the G, M, and NS proteins. By hybridization experiments, virtually no sequence homology was detected between the mRNA's of the two serotypes. Despite this lack of overall homology, the 12 to 18S mRNA species of both serotype contained a common 5'-terminal hexanucleotide sequence, G(5')ppp(5')A-A-C-A-G. The signicance of this finding in light of specific interactions between the two serotypes of VSV in vivo is discussed.
...
PMID:In vitro RNA transcription by the New Jersey serotype of vesicular stomatitis virus. I. Characterization of the mRNA species. 20 24

The 2S RNA synthesized in vitro by the RNA polymerase of a defective interfering (DI) particle of vesicular stomatitis virus was labeled at its 3' terminus with 32P-cytidine 3', 5' bisphosphate and RNA ligase. Analysis of the labeled RNA showed that it was a family of RNAs of different length but all sharing the same 5' terminal sequence. The largest labeled RNA was purified by gel electrophoresis, and the sequence of 41 of its 46 nucleotides was determined by rapid RNA sequencing methods. The assignment of the remaining 5 nucleotides was made on the basis of an analysis of one of the smaller RNAs and published data. A new approach in RNA sequencing based on the identification of 3' terminal nucleotides of rna fragments originally present in the DI product or generated during the ligation reaction confirmed most of the sequence. The complete sequence of this 46 nucleotide long plus-sense RNA is: ppACGAAGACCACAAAACCAGAUAAAAAA UAAAAACCACAAGAGGGUC-OH. This RNA anneals to the RNA of the DI particle from which it was synthesized, indicating that its synthesis is template-specified. At least the first 17 and possibly all of the nucleotides are also complementary to sequences at the 3' end of two other VSV DI particles which were derived independently and whose genomes differ significantly in length. These data suggest a common 3' terminal sequence among all VSV DI particles which contain part of the Lgene region of the parental genome.
...
PMID:The complete sequence of a unique RNA species synthesized by a DI particle of VSV. 21 97

The L and NS proteins of vesicular stomatitis virions (New Jersey serotype) were solubilized with Triton X-100 and high-salt buffer and recombined with purified nucleocapsids under conditions similar to those used to reconstitute transcriptase activity in vitro. The nucleocapsid-bound L and NS proteins were separated from unbound proteins on a glycerol gradient. The rebinding of L and NS proteins mimics the in vivo binding in that at saturation the ratio of L and NS molecules to N molecules is approximately the same as observed in the intact virion. L and NS proteins were separated and added back independently and in combination to the template. The purified NS protein bound to the template in the absence of L protein. However, the L protein binding appeared to depend on the presence of NS protein. The presence of Mg2+ and nucleotides, which is required for transcription, was not necessary for the rebinding of L and NS proteins.
...
PMID:Rebinding of transcriptase components (L and NS proteins) to the nucleocapsid template of vesicular stomatitis virus. 21 81

We have sequenced the endogenous RNA polymerase product produced by disrupted purified virions of vesicular stomatitis virus defective interfering particles by using the newer one-dimensional rapid gel sequencing techniques and confirming this with a modified two-dimensional gel vectoring technique. The sequence of this 46-nucleotide RNA is: 5'(pp)pACGAAGACCACAAAACCA-GAUAAAAAAUAAAAACCACAAGAGGG(U)COH3'. We infer that this sequence is identical to the sequence at the 5' end of infectious vesicular stomatitis virus RNA and is complementary to the sequence of the 3'-OH terminus of this defective interfering particle genome RNA.
...
PMID:Sequence of a RNA templated by the 3'-OH RNA terminus of defective interfering particles of vesicular stomatitis virus. 21 96

An endogenous transcriptase inhibitor active at high concentrations of vesicular stomatitis (VS) virus was present in trypsinized whole virions but was absent from ribonucleoprotein cores containing only the L, N, and NS proteins. Poly(L-glutamic acid) effectively reversed the transcriptase inhibition. Transcription under noninhibited, inhibited, and poly(L-glutamic acid)-reversed conditions did not appear to greatly affect the nature of the RNA transcription product. The VS virion matrix (M) protein was purified to greater than 98% homogeneity and was found to have an isoelectric point of approximately 9.0. Purified M protein inhibited transcription by ribonucleoprotein cores, an effect that was partially reversed by poly(L-glutamic acid). Two group III temperature-sensitive (ts) mutants of VS virus (tsO23 and ts G31) with lesions in the M protein exhibited little or no endogenous inhibitor activity compared with two wild-type strains and a group V mutant (tsO45) with a lesion in the G protein. The data presented strongly suggest that the virion M protein is responsible for the endogenous inhibition of in vitro RNA synthesis seen at high concentrations of VS virus.
...
PMID:Role of the membrane (M) protein in endogenous inhibition of in vitro transcription by vesicular stomatitis virus. 21 13

Infection of mouse myeloma (MPC-11) cells with vesicular stomatitis virus resulted in rapid loss in activity of cellular RNA polymerases associated with nuclear chromatin. No RNA polymerase inhibitor could be detected in extracts of infected cell nuclei. Reconstitution experiments with solubilized RNA polymerases dissociated from chromatin of infected and uninfected cells demonstrated that vesicular stomatitis viral infection did not affect the ability of the polymerases to function on endogenous or exogenous templates; nor did infection alter the template capability of the chromatin. Measurement of the number of actively growing RNA chains revealed that infected cell nuclei contained fewer active polymerase units; however, the rates of RNA chain elongation were the same in nuclei from infected and uninfected cells. Quantitation of the number of polymerase units active in nuclear chromatin revealed that the alpha-amantin-sensitive polymerase II was more severely reduced by viral infection than were polymerases I and III.
...
PMID:Vesicular stomatitis virus infection reduces the number of active DNA-dependent RNA polymerases in myeloma cells. 22 70


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>