Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.7.7.49 (reverse transcriptase)
31,746 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Short term cultures of bovine leukemic lymphocytes release virus particles with biochemical properties of RNA oncogenic viruses. These particles, tentatively called Bovine Leukemia Virus (BLV) have a high molecular weight-reverse transcriptase complex and a density averaging 1.155 g/ml in sucrose solutions. Molecular hybridizations between BLV-3H cDNA and several viral RNAs show that BLV is not related to Mason-Pfizer Monkey Virus (MPMV) Simian Sarcoma Associated Virus (SSV-1) Feline Leukemia Virus (FeLV) or Avian Myeloblastosis Virus (AMV). Rauscher Leukemia Virus (RLV) exhibits a slight but reproducible relatednesse to BLV. The high preference of BLV reverse transcriptase for Mg++ as the divalent cation suggests that BLV might be an atypical mammalian leukemogenic type C virus. Hybridization studies using BLV 3H cDNA as a probe suggest that the DNA of bovine leukemic cells contains viral sequences that cannot be detected in normal bovine DNA.
...
PMID:Bovine leukemia virus: an exogenous RNA oncogenic virus? 6 82

Rauscher leukemia virus RNA-directed DNA polymerase has been purified to near homogeneity (greater than 90% pure) using affinity chromatography on polycytidylate-agarose with over 85% recovery of input enzymatic activity. The purified enzyme has a molecular weight of approximately 70,000 and appears to consist of a single polypeptide chain. The enzyme is free of DNase, but has RNase H activity. Analysis of the requirements for optimal rates of DNA synthesis by this enzyme using synthetic and natural template-primers has revealed template-specific variations in such requirements. During these studies it was observed that DNA synthesis catalyzed by Rauscher leukemia virus DNA polymerase is inhibited by the addition of inorganic phosphate. An analysis of the mechanism of phosphate inhibition was carried out using the synthetic template-primer poly(A)-(dT)10. It appears that by some mechanism, possibly involving the substrate binding site of the enzyme, phosphate ions inhibit DNA synthesis with a more acute effect on the rate of chain growth than on that of initiation. The extension of these studies to DNA synthesis catalyzed by a variety of mammalian type C viral reverse transcriptases revealed that low levels ( less than or equal to 2 mM) of inorganic phosphate strongly inhibited DNA synthesis. The susceptibility to phosphate inhibition appears unique to mammalian type C viral enzymes since the type B viral enzyme, Escherichia coli DNA polymerase I, avian myeloblastosis virus and Mason Pfizer monkey tumor virus reverse transcriptase and cellular DNA polymerases alpha and gamma are not inhibited by inorganic phosphate. This phenomenon of phosphate inhibition of various DNA polymerases, therefore, provides a new basis for the differentiation of the sources and nature of these enzymes.
...
PMID:Purification and properties of Rauscher leukemia virus DNA polymerase and selective inhibition of mammalian viral reverse transcriptase by inorganic phosphate. 6 68

DNA, complementary to chicken globin mRNA was synthesized using either Avian Myeloblastosis virus reverse transcriptase, or E. coli DNA polymerase I. Transcriptase cDNA sediments at 9 S on sucrose gradients, and is 620 nucleotides in length, representing a complete copy of globin mRNA template. In contrast, Polymerase I cDNA sediments at 4 S, is 100 to 200 nucleotides in length, and is a copy of a small region at the 3'(poly A) end of globin mRNA. Similarly, Transcriptase cDNA and Polymerase I cDNA hybridize to globin mRNA template with characteristic, individual Crot1/2 values. The Crot1/2 value for Transcriptase cDNA hybridization is 7 X 10(-4) mol s 1(-1), and that for Polymerase I cDNA is 5 X 10(-3). This work shows that Avian Myeloblastosis virus reverse transcriptase can use Polymerase I cDNA to prime further cDNA synthesis along the mRNA template. The product of extended cDNA synthesis is identical in length and hybridization properties to oligo (dT) primed transcriptase cDNA.
...
PMID:Gene specific priming of complementary DNA synthesis. 6 22

C-type particles secreted in vivo by MOPC-315 myeloma cells were characterized. These particles localize at a density of 1-16 g/ml in sucrose and possess a 60 to 70S RNA and an RNA-instructed DNA polymerase. Endogenous enzyme activity requires manganese and is inhibited by ribonuclease or by the omission of any of the deoxynucleoside triphosphates. The enzyme utilizes the virus 60 to 70S RNA as a template to synthesize DNA molecules which specifically hybridize to the homologous RNA.
...
PMID:RNA-instructed DNA polymerase associated with C-type particles produced in vivo by murine myeloma cells. 6 43

The alpha, beta2, and alphabeta forms of the RNA-dependent DNA polymerase of avian sarcoma virus B77 grown in duck embryo fibroblasts have been compared with respect to several kinetic properties. The following results were obtained. 1. The Km values for dTTP and dGTP for enzyme forms alpha, beta2, and alphabeta were 77, 39, and 74, and 6.8, 3.1, and 6.1 micronM, respectively. 2. The affinity of 70 S Rous sarcoma virus RNA for enzyme form alphabeta was about twice that for the other two forms. 3. The relative specific activities of the three enzyme forms on synthetic primer-templates such as poly(rA)-poly(dT) were almost the same. The viral 70 S RNA-dependent specific activities were 2 to 3 orders of magnitude lower and in the ratio of 1:3:5 for enzyme forms alpha:beta2:alphabeta. Addition of exogenous oligo(dT) stimulated the 70 S viral RNA-dependent activity of enzyme forms alphabeta and beta2 by a factor of 3, and that of enzyme form alpha by a factor of 30, so that it then became the most active transcriptase of viral 70 S RNA. 4. The largest transcripts formed by the three enzyme forms with 70 S viral RNA as primer-template were about 4,500 nucleotides long. About one-third of the total amount of polynucleotides polymerized by the alphabeta enzyme was in the form of such transcripts. This proportion was far higher than for the other two enzyme forms. 5. All three enzyme forms were capable of transcribing single-stranded into double-stranded DNA. 6. The 3-propylcyclohexyl piperidyl derivative of rifamycin SV, at a concentration of 100 microng/ml, inhibited enzyme forms beta2 and alphabeta by over 99.5 and 96%, respectively, but enzyme form alpha by only about 60%. 7. The beta2 and alphabeta forms of the enzyme were processive DNA polymerases, the alpha form a nonprocessive polymerase. 8. In general, these results indicate that in most respects the properties of the dimeric enzyme forms resemble each other much more closely than those of the alpha form. In some very important respects, such as affinity for viral RNA and the size of transcripts formed from it, the alphabeta enzyme form performs significantly better than either of the other two enzyme forms.
...
PMID:RNA-dependent DNA polymerase of avian sarcoma virus B77. II. Comparison of the catalytic properties of the alpha, beta2, and alphabeta enzyme forms. 6 35

When Rous sarcoma virus RNA is transcribed into DNA by the reverse transcriptase, a tRNA primer is elongated into DNA. The primer is near the 5' end of the virus genome; the first major DNA made is a "run-off" product extending 101 bases from the primer to the 5' end of the template. We have studied this DNA molecule to determine the sequence of the first 101 bases at the 5' end of the Rous sarcoma virus genome (Prague strain, subgroup C). Twenty-one bases at the extreme 5' end are also at the 3' end of the virus genome (see D. E. Schwartz, P. C. Zamecnik, and H. L. Weith, this issue, pp. 994-998), and thus this virus is terminally redundant. The existence of this sequence repetition immediately suggests mechanisms by which the growing DNA copy can jump from the 5' end to a 3' end of the template and become circular. The sequence also displays a possible ribosome binding site and enough secondary structure to permit a possible 5'-5' linkage of viral RNA molecules.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 5' sequence. 6 83

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84

These studies were designed to determine if RIDP was present in a particulate fraction of brains from patients with ALS and PD. Evidence that we have detected RIDP is as follows: (a) DNA polymerase activity persists in the presence of concentrations of actinomycin D and distamycin that inhibit most DNA-directed DNA synthesis (25); (b) the majority of endogenous DNA polymerase activity is sensitive to prior treatment with RNase; (c) the early reaction product is a 4-5 S DNA heteropolymer joined by hydrogen bonds to an RNA molecule; and (d) the purified [3H]DNA product anneals to RNA extracted from the enzyme-containing pellet more extensively than to normal brain RNA or poly(rA). The enzyme activity is in a cytoplasmic particle that can be sedimented at high speed and has the buoyant density of RNA tumor viruses (1.16-1.18 gm/ml). This particulate fraction is not disrupted by physical manipulation and maintains its characteristic density with repeated centrifugations. Treatment with the nonionic surfactant Sterox changes the buoyant density of the enzyme-containing particle to 1.24 gm/ml, the density of the onconavirus virion core. Synthesis of RNA-DNA hybrids by an endogenous reverse transcriptase reaction was found only in normal and diseased Chamorro brains. Examination of a limited number of normal and diseased brains from individuals who lived in the United States produced negative results (39). Definitive characterization of this polymerase activity and identification as a true viral polymerase will depend on purification of biochemically active quantities of this polymerase to determine its template specificities, its cation preference, the fidelity of its transcription product, as well as its antigenic relationship to animal virus and human leukemic RIDP. Of critical importance in these studies will be differentiation of this activity from normal brain DNA polymerase gamma and terminal deoxynucleotidyltransferase.
...
PMID:RNA tumor viruses as causative agents of chronic neurological disease. 6 87

The purpose of this investigation was to search for oncornavirus in primary cell cultures obtained from leukemic cattle organs and lymphocytes and to study their molecular-biological properties and role in the etiology of cattle leukemia. The investigation was carried out on 25 primary trypsinized cell culutres of lymph nodes, spleens, kidneys and lymphocytes from cattle with acute and chronic leukemia. It was demonstrated that all cell cultures from leukemic cattle (in contrast to cell cultures from healthy cattle) released oncornavirus into the culture medium. The virus possesses the main properties of oncornaviruses: it has a virion of C-type structure with a density of 1.16--1.18g/ml in a 20--60 per cent sucrose gradient, which may be induced by 5-bromodeoxyuridine, inhibited by Actino-mycin D, has reverse transcriptase activity, contains 60S RNA, that is annealed in the reaction of molecular hybridization with DNA of lymph nodes of cattle with leukemia. The propagation of the isolated oncornavirus in continuous cell lines of calf kidney culture was demonstrated. Experimental inoculation of purified oncornavirus was carried out on 60 baby calves and 15 lambs from leukosis free herds or flocks. Several of the calves later showed evidence of virus infection.
...
PMID:Isolation and characterisation of oncornavirus from primary cultures of tissues from cattle with leukemia. 6 13

Bleomycin inhibits cellular RNA synthesis and the inhibition is nonspecific. The ratio of polyadenylate- [poly(A)] containing RNA to non-poly(A)-containing RNA in the drug-treated human lymphocytic cells, line Wil2, was the same as that in untreated cells. Poly(A) RNA isolated from untreated cells was used as a template for reverse transcriptase to synthesize complementary DNA, which was then used as a probe to assay the sequence diversity of poly(A)RNA's from treated and untreated cells. It was found that essentially all of the poly(A) RNA's in the untreated cells were also present in the treated cells. The effect of bleomycin on the biological activity of messenger RNA (mRNA) was tested with globin mRNA in a wheat germ embryo translation system. Although bleomycin inhibited protein synthesis at high concentrations, the inhibition was not due to a modification of mRNA. This was evidenced by the fact that no decrease in the ability of mRNA to function in the test system was found when globin mRNA was pretreated with high concentrations of bleomycin followed by removal of the drug.
...
PMID:Effect of bleomycin on the synthesis and function of RNA. 6 80


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>

---