Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.7.49 (
reverse transcriptase
)
31,746
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Procedures were established for the isolation and partial purification of
DNA polymerase
, RNA polymerase and poly(A) polymerase activities from the cytoplasm and nuclei of NIH-Swiss mouse embryos. Based on the elution pattern of these enzyme activities from DEAE-cellulose and phosphocellulose columns in Tris-HCl buffer, pH 8.0, the apparent basicities of the enzymes can be arranged as follows: cytoplasmic(C) poly(A) polymerase greater than (C)
DNA polymerase beta
greater than (C)
DNA polymerase alpha
and nuclear(N) poly(A) polymerase greater than (N)
DNA polymerase
greater than (N)RNA polymerase I greater than (N)RNA polymerase II. Twenty rifamycins, including rifamycin B, rifamycin S, rifamycin SV, and rifamycin SV derivatives, were examined for their ability to inhibit the above mentioned nucleic acid polymerizing enzymes and Simian sarcoma virus type I (SSV-1)
reverse transcriptase
. Rifamycin SV 3'-formyldiphenylhydrazone, rifamycin SV 3'-formyl-n-octyloxime (AF/013) and rifamycin SV 3'-formyldiphenylmethyloxime (AF/05) inhibited all the tested enzyme activities. Rifamycin SV 3'-formylpropylphenyloxime (AF/015) inhibited cellular nucleic acid polymerase activities but not SSV-1
DNA polymerase
activity. Rifamycin SV 3'-formyldinitrophenylhydrazone (AF/DNFL) strongly inhibited
reverse transcriptase
activity but did not inhibit cellular
DNA polymerase
activities. AF/DNFI slightly inhibited RNA and poly(A) polymerase activities. Rifamycin SV 3'-formyldipropylhydrazone (AF/DPI) and 2,6-dimethyl-4-N-benzyldemethyl-rifampicin (AF/ABDMP) slightly inhibited
reverse transcriptase
activity but did not inhibit cellular nucleic acid polymerase activities. Active rifamycin derivatives inhibited enzyme reactions by interacting with the enzyme proteins. Nascent polynucleotide chain elongation continued although at a reduced rate in the presence of inhibitor. The addition of increasing concentrations of nonionic detergent (Triton X-100) to rifamycin-inhibited enzyme reactions fully restored enzyme activities. The presence of highly lipophilic 3'-side chains on active rifamycins and the reversibility of enzyme inhibition by Triton X-100 suggest that the tested nucleic acid polymerizing enzymes may have hydrophobic regions with which inhibitory rifamycins interact.
...
PMID:Interaction of rifamycins with mammalian nucleic acid polymerizing enzymes. 6 93
Radioactively labelled DNAs (5 X 10(6) cpm/mug) complementary to human 18 S and 28 S ribosomal RNA were synthesized using
RNA-directed DNA polymerase
(
EC 2.7.7.7
). These complementary DNAs were used to measure human ribosomal gene numbers by two independent methods, both of which indicated numbers at least four-fold lower than those previously reported. First, the kinetics of the annealing of the complementary DNAs with total human placental DNA indicated that the number of both 18-S and 28-S ribosomal genes per haploid genome is approximately 50. Second, saturation experiments in which a constant amount of DNA was annealed with increasing amounts of complementary DNA also indicated that the number of 28 S ribosomal RNA genes in human placental and spleen DNA is is about 50 per haploid genome.
...
PMID:A new estimate of human ribosomal gene number. 6 94
The myelogenous leukemia cell line K-562 with a Ph1+chromosome, derived from a patient with chronic myelogenous leukemia in terminal blastic crisis, is not a bone marrow-derived lymphoblastic cell line, because the cells neither produce immunoglobulins nor possess complement receptors. Since it has been suspected that blasts found in some patients with chronic myelogenous leukemia in blastic crisis might be thymus-derived cells, we have studied several parameters to demonstrate that K-562 cells are not thymus-derived lymphoblasts. The results of this study show: (a) no cross-reactivity of antisera to K-562 cells with normal human thymocytes; (b) lack of cytotoxicity of a specific horse anti-human thymocyte globulin for K-562 cells; (c) failure of the treatment of K-562 cells with bovine thymosin to induce antigenic determinant and erythrocyte rosette receptors on K-562 cells; (d) presence of receptors for the Fc portion of immunoglobulin G; (e) absence of terminal deoxynucleotidyl transferase; and (f) cytotoxicity of monkey antiserum to K-562 cells for malignant thymus-derived cells (Molt-4). However, absorption with Molt-4 cells abolished the cross-reactivity with Molt-4 cells, whereas 60% of the antibody to K-562 cells remained in the immune serum. Studies of
DNA polymerase
activities revealed that K-562 cells have levels of polymerase alpha and beta, like other proliferating cells, and an
RNA-dependent DNA polymerase
activity, presumably representing polymerase gamma.
...
PMID:Absence of thymus-derived lymphocyte markers in myelogenous leukemia (Ph1+) cell line K-562. 6 24
Complexes of high-molecular-weight RNA and
reverse transcriptase
(RNA-dependent
DNA nucleotidyltransferase
) have been detected in 14(77.8%) of 18 spleen from patients with Hodgkin's disease and in all samples tested of peripheral leukocytes and spleens from leukemic patients. The enzyme and its template are localized in a particle having a density between 1.16 and 1.19 g/ml. These observations describe characteristic features of RNA tumor viruses.
...
PMID:Simultaneous detection of reverse transcriptase and high molecular weight RNA in tissue of patients with Hodgkin's disease and patients with leukemia. 6 53
Rauscher leukemia virus
RNA-directed DNA polymerase
has been purified to near homogeneity (greater than 90% pure) using affinity chromatography on polycytidylate-agarose with over 85% recovery of input enzymatic activity. The purified enzyme has a molecular weight of approximately 70,000 and appears to consist of a single polypeptide chain. The enzyme is free of DNase, but has RNase H activity. Analysis of the requirements for optimal rates of DNA synthesis by this enzyme using synthetic and natural template-primers has revealed template-specific variations in such requirements. During these studies it was observed that DNA synthesis catalyzed by Rauscher leukemia virus
DNA polymerase
is inhibited by the addition of inorganic phosphate. An analysis of the mechanism of phosphate inhibition was carried out using the synthetic template-primer poly(A)-(dT)10. It appears that by some mechanism, possibly involving the substrate binding site of the enzyme, phosphate ions inhibit DNA synthesis with a more acute effect on the rate of chain growth than on that of initiation. The extension of these studies to DNA synthesis catalyzed by a variety of mammalian type C viral reverse transcriptases revealed that low levels ( less than or equal to 2 mM) of inorganic phosphate strongly inhibited DNA synthesis. The susceptibility to phosphate inhibition appears unique to mammalian type C viral enzymes since the type B viral enzyme, Escherichia coli
DNA polymerase I
, avian myeloblastosis virus and Mason Pfizer monkey tumor virus
reverse transcriptase
and cellular DNA polymerases alpha and gamma are not inhibited by inorganic phosphate. This phenomenon of phosphate inhibition of various DNA polymerases, therefore, provides a new basis for the differentiation of the sources and nature of these enzymes.
...
PMID:Purification and properties of Rauscher leukemia virus DNA polymerase and selective inhibition of mammalian viral reverse transcriptase by inorganic phosphate. 6 68
DNA, complementary to chicken globin mRNA was synthesized using either Avian Myeloblastosis virus
reverse transcriptase
, or E. coli
DNA polymerase I
. Transcriptase cDNA sediments at 9 S on sucrose gradients, and is 620 nucleotides in length, representing a complete copy of globin mRNA template. In contrast, Polymerase I cDNA sediments at 4 S, is 100 to 200 nucleotides in length, and is a copy of a small region at the 3'(poly A) end of globin mRNA. Similarly, Transcriptase cDNA and Polymerase I cDNA hybridize to globin mRNA template with characteristic, individual Crot1/2 values. The Crot1/2 value for Transcriptase cDNA hybridization is 7 X 10(-4) mol s 1(-1), and that for Polymerase I cDNA is 5 X 10(-3). This work shows that Avian Myeloblastosis virus
reverse transcriptase
can use Polymerase I cDNA to prime further cDNA synthesis along the mRNA template. The product of extended cDNA synthesis is identical in length and hybridization properties to oligo (dT) primed transcriptase cDNA.
...
PMID:Gene specific priming of complementary DNA synthesis. 6 22
Three forms of the
RNA-dependent DNA polymerase
were isolated from highly purified avian sarcoma virus B77 grown in duck embryo fibroblasts, using sequential chromatography on DEAE-cellulose, phosphocellulose, and poly(U)-cellulose. One form, which sedimented with about 5.2 S, contained only one species of polypeptide, with a molecular weight of 63,000; a second sedimented with about 7.8 S and contained only one species of polypeptide with a molecular weight of 81,000; and a third form, which sedimented with about 7.3 S, contained two species of polypeptides with molecular weights of 63,000 and 81,000. The molecular constitution of the three enzyme forms were therefore alpha, beta2, and alphabeta. All three possessed almost the same specific activity with poly(rA)-oligo(dT) as the primer-template. Forms alpha and alphabeta of avian sarcoma virus
DNA polymerase
have already been described in the literature; form beta2 is a new form. All three forms possessed ribonuclease H activity, the relative specific activities of the alpha, beta2, and alphabeta forms being about 1:4:5. All three enzyme forms were inhibited by antiserum to the alphabeta form, but whereas the alpha and alphabeta forms could be inhibited about 95%, the maximum degree of inhibition of the beta2 form was about 80%. The three enzyme forms also differed with respect to heat stability at 46 degrees, the monomeric alpha form of the enzyme being only about one-half as stable as the two dimeric forms.
...
PMID:RNA-dependent DNA polymerase of avian sarcoma virus B77. I. Isolation and partial characterization of the alpha, beta2, and alphabeta forms of the enzyme. 6 34
An antigen crossreacting with the 30,000-molecular-weight protein (p30) of the feline endogenous oncornavirus (RD114) was detected in a well-characterized human fibrosarcoma cell line, HT1080, by indirect immunofluorescence. Three antisera against RD114 p30 gave similar positive results, while two antisera prepared against simian sarcoma virus p30, one antiserum prepared against murine leukemia virus p30, and one antiserum prepared against feline leukemia virus p30 gave no immunofluorescence. The reactivity observed with the antiserum against RD114 p30 was detected in 10-40% of the cells at early passages and was no longer expressed by the forty-first subculture. The reactivity could be removed by adsorption of the antiserum with RD114-infected dog or human cells, but not by uninfected cells or by cells infected with an antigenically unrelated oncornavirus, feline leukemia virus. Neither complete virus particles nor
reverse transcriptase
(RNA-dependent
DNA nucleotidyltransferase
) activity was detected in the culture. These experiments suggest that the fibrosarcoma cell line is expressing an antigen related to the p30 protein of RD114 baboon endogenous virus group of oncornaviruses without producing complete virions.
...
PMID:Expression of antigenic crossreactivity to RD114 p 30 protein in a human fibrosarcoma cell line. 6 79
A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified
reverse transcriptase
(
RNA-directed DNA polymerase
; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase,
EC 2.7.7.7
) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by
reverse transcriptase
which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84
These studies were designed to determine if RIDP was present in a particulate fraction of brains from patients with ALS and PD. Evidence that we have detected RIDP is as follows: (a)
DNA polymerase
activity persists in the presence of concentrations of actinomycin D and distamycin that inhibit most DNA-directed DNA synthesis (25); (b) the majority of endogenous
DNA polymerase
activity is sensitive to prior treatment with RNase; (c) the early reaction product is a 4-5 S DNA heteropolymer joined by hydrogen bonds to an RNA molecule; and (d) the purified [3H]DNA product anneals to RNA extracted from the enzyme-containing pellet more extensively than to normal brain RNA or poly(rA). The enzyme activity is in a cytoplasmic particle that can be sedimented at high speed and has the buoyant density of RNA tumor viruses (1.16-1.18 gm/ml). This particulate fraction is not disrupted by physical manipulation and maintains its characteristic density with repeated centrifugations. Treatment with the nonionic surfactant Sterox changes the buoyant density of the enzyme-containing particle to 1.24 gm/ml, the density of the onconavirus virion core. Synthesis of RNA-DNA hybrids by an endogenous
reverse transcriptase
reaction was found only in normal and diseased Chamorro brains. Examination of a limited number of normal and diseased brains from individuals who lived in the United States produced negative results (39). Definitive characterization of this polymerase activity and identification as a true viral polymerase will depend on purification of biochemically active quantities of this polymerase to determine its template specificities, its cation preference, the fidelity of its transcription product, as well as its antigenic relationship to animal virus and human leukemic RIDP. Of critical importance in these studies will be differentiation of this activity from normal brain
DNA polymerase
gamma and terminal deoxynucleotidyltransferase.
...
PMID:RNA tumor viruses as causative agents of chronic neurological disease. 6 87
<< Previous
1
2
3
4
5
6
7
8
9
10
Next >>