Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.7.49 (
reverse transcriptase
)
31,746
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
Melanoma
lesions that develop in the same patient at different times or simultaneously at different locations may differ antigenically, because malignant melanoma is heterogeneous in terms of its biological, immunological and metastatic properties. The objective of this study was to characterize the molecular profiles of melanoma cells in peripheral blood, lymph nodes and metastatic tissues, employing the messenger RNA (mRNA) expression of tyrosinase, melanoma-inhibiting activity (MIA) and melanoma antigen recognized by T cells-1 (MART-1) as markers. Samples of cells propagated from metastatic sites were obtained from 17 stage III/IV melanoma patients and assayed by
reverse transcriptase
-polymerase chain reaction (RT-PCR), using specific primers for each marker. In eight patients, marker profiles were analysed in simultaneously obtained specimens of peripheral blood, lymph nodes and metastatic tissues originating from the same patient. Tyrosinase, MIA and MART-1 were expressed in 59%, 76% and 76% of the metastases, respectively. Simultaneously obtained specimens of peripheral blood, lymph nodes and metastatic tissues showed a high degree of homogeneity: 60%, 75% and 20% for tyrosinase, MIA and MART-1, respectively. Our findings suggest that the rather homogeneous expression pattern found in different tumour sites analysed in the same patient is of potential prognostic and therapeutic importance. Furthermore, melanoma lesions may be negative for the expression of antigens such as MART-1, and discrepancies in expression patterns between peripheral blood and metastatic tissues may occur, especially for this marker. Finally, our findings support the notion that molecular screening using an RT-PCR approach is appropriate in this kind of investigation.
Melanoma
Res 2004 Oct
PMID:Molecular detection of MART-1, tyrosinase and MIA in peripheral blood, lymph nodes and metastatic sites of stage III/IV melanoma patients. 1545 91
The sentinel lymph node (SLN) is the first draining node from the area in which a tumour is located. The presence or absence of SLN micrometastasis is an important prognostic factor for melanoma. As the first dissemination route for melanoma is lymphatic and we know that the immune system plays an important role in melanoma response, we hypothesize that melanoma and its corresponding SLN should constitute an immunological unit. Small portions of 54 SLNs from 37 patients undergoing selective lymphadenectomy were subjected to quantitative
reverse transcriptase
-polymerase chain reaction (qRT-PCR) to quantify messenger RNA (mRNA) transcripts of the following genes: tyrosinase, telomerase, cyclooxygenase-1 (COX-1), COX-2, granulocyte-macrophage colony-stimulating factor (GM-CSF), interleukin-2 (IL-2), interferon-gamma (IFN-gamma), IL-4, IL-10 and IL-12. In addition, 11 non-sentinel lymph nodes (NSLNs) were excised from 11 of the 37 patients and the same study was performed. Immunohistochemistry with different antibodies against dendritic cells (DCs) was performed in 10 pairs of SLNs and NSLNs. Significantly higher mRNA expression of COX-2, GM-CSF, IFN-gamma and IL-10 was found in SLNs compared with NSLNs in the overall group. DCs, as labelled by S-100 and CD1a, were significantly decreased in NSLNs compared with SLNs. These data suggest that the initial increase in GM-CSF observed in SLNs could lead to the attraction of a high number of DCs to SLNs. However, the presence of certain immunosuppressive molecules, such as IL-10 and COX-2, could block their maturation and their ability to become efficient antigen presenters.
Melanoma
Res 2005 Apr
PMID:Cytokine expression and dendritic cell density in melanoma sentinel nodes. 1584 42
In the present study, we constructed a pEgr-tumour necrosis factor-alpha (TNFalpha) plasmid and investigated its expression properties in B16 cells on exposure to ionizing irradiation and, furthermore, the effect of gene radiotherapy on a melanoma model. Firstly, the recombinant pEgr-TNFalpha plasmid was constructed and transfected into B16 cells with liposomes to investigate its expression properties on exposure to X-irradiation. The melanoma-bearing model was then established and the tumour tissue was injected locally with the pEgr-TNFalpha plasmid and exposed to 20 Gy of X-irradiation. The tumour growth curve at different time points was described. At day 3, TNFalpha transcription in the tumour tissue was detected by
reverse transcriptase
-polymerase chain reaction (RT-PCR). The results showed that: (1) the eukaryotic expression vector pEgr-TNFalpha was successfully constructed and transfected into B16 cells; (2) TNFalpha expression was significantly increased in the transfected cells after X-irradiation, in contrast with that of the pCMV-TNFalpha group or the pEgr-TNFalpha group that received 0 Gy of irradiation; (3) after pEgr-TNFalpha gene radiotherapy, tumour growth was significantly slower than in those groups receiving irradiation or gene transfer alone. The TNFalpha concentration in the peripheral blood of tumour-bearing mice that received an injection of pEgr-TNFalpha and 20 Gy of irradiation was higher than that of the control group. Only in pEgr-TNFalpha and pEgr-TNFalpha + 20 Gy groups was TNFalpha messenger RNA (mRNA) detected in the tumour tissue. We conclude that pEgr-TNFalpha gene radiotherapy may significantly inhibit tumour growth, and that the anti-melanoma effect is superior to that of either gene therapy or radiotherapy alone. Our work provides the theoretical basis for further study on the gene radiotherapy of this tumour.
Melanoma
Res 2005 Jun
PMID:Effect of pEgr-TNFalpha gene radiotherapy on mice melanoma. 1591
Proteomics provides a powerful approach for screening alterations in protein expression and post-translational modification associated with particular human diseases. In this study, the analysis of protein expression was focused on malignant melanoma in order to determine the candidate genes involved in tumour progression. The proteomes of cultured melanocytes and of cell lines from primary and metastatic lesions of one malignant melanoma patient were profiled using two-dimensional electrophoresis (2-DE) and mass spectrometry. Differentially expressed proteins were confirmed by 2-DE and mass spectrometry on an additional four malignant melanoma cell lines. Total RNA from the first subset of cell lines was used for quantitative
reverse transcriptase
-polymerase chain reaction (RT-PCR) of the candidate genes identified after proteomics analysis. A very high similarity was observed in the 2-DE maps of two malignant melanoma cell lines derived from primary and secondary lesions of the same patient. Mass spectrometry identified 37 proteins which were found to be more abundant in tumour cells in comparison with control melanocytes (as confirmed on additional cell lines), with a relatively high prevalence of stress proteins. Eight candidate genes (PRDX2, HSP27, HSP60, HSPA8, HSP9B, STIP1, PDI and P4HB) were further characterized by evaluating their messenger RNA expression levels through real-time RT-PCR analysis. Overexpression of HSP27, HSP60 and HSPA8 and downregulation of PRDX2 were observed in cells from metastatic malignant melanoma in comparison with those from primary melanoma. Although further investigations with larger numbers of paired normal and tumour samples are needed, our findings strongly suggest that the dysregulation of stress pathways may be involved in melanoma progression.
Melanoma
Res 2005 Aug
PMID:Analysis of candidate genes through a proteomics-based approach in primary cell lines from malignant melanomas and their metastases. 1603
This study was conducted to examine the prognostic impact of four biomarkers [tyrosinase and MART-1 messenger RNA (mRNA), S100beta protein and lactate dehydrogenase (LDH)] in patients with metastatic melanoma, together with established clinical factors. Tyrosinase and MART-1 mRNA were measured by quantitative
reverse transcriptase
-polymerase chain reaction (RT-PCR). S100beta was measured using a commercially available immunoassay, and LDH was analysed conventionally. All markers were measured in blood samples before interleukin-2-based immunotherapy in 85 patients with metastatic melanoma. LDH, S100beta, tyrosinase, number of metastatic sites, location of metastatic sites and performance status were all significant factors for survival in univariate analyses. In multivariate analysis, tyrosinase [hazard ratio (HR)=1.6; 95% confidence interval (CI), 1.1-2.6; P=0.04] and LDH (HR=2.0; 95% CI, 1.1-3.5; P=0.02) were both independent prognostic factors for survival. A combination variable of tyrosinase and LDH remained independently associated with survival (P=0.04) after adjusting for the American Joint Committee on Cancer (AJCC) stage IV classification in a multivariate analysis involving both models. It can be concluded that tyrosinase mRNA and elevated LDH are independent prognostic factors for poor survival in this group of 85 patients. Additional studies are needed before the prognostic value of tyrosinase mRNA in metastatic melanoma can be firmly established. Further evaluation of the combined measurement of tyrosinase mRNA and LDH is warranted.
Melanoma
Res 2005 Oct
PMID:Tyrosinase messenger RNA in peripheral blood is related to poor survival in patients with metastatic melanoma following interleukin-2-based immunotherapy. 1617 68
Tyrosinase-based
reverse transcriptase
-polymerase chain reaction (RT-PCR) is a method for the detection of circulating melanoma cells in peripheral blood. To our knowledge, no long-term studies on the prognostic impact of tyrosinase PCR in uveal melanoma have yet been reported. In this prospective, non-randomized, observational cohort study, we included 41 patients with uveal malignant melanoma. RT-PCR for tyrosinase was performed in each patient before and after treatment. A clinical follow-up was performed for each patient for at least 5 years, including chest X-ray, serum liver enzyme determination, ultrasound of the liver and bone scintigraphy. The PCR results, age of the patients, tumour size, tumour location, tumour therapy, internal reflectivity, histology, development of distant metastasis and survival rate during follow-up were analysed. At the time of diagnosis, tyrosinase messenger RNA (mRNA) in peripheral blood, suggesting the presence of circulating melanoma cells, was detected in 16 of the 41 patients. Sixty-nine percent of the PCR samples with a positive result prior to therapy revealed a negative result after therapy. The internal reflectivity of the tumour (P=0.021) and the 5-year survival (P=0.023) showed a statistically significant association with positive PCR. It can be concluded that tyrosinase RT-PCR is a sensitive method for the detection of melanoma cells in peripheral blood. This study indicates that the presence of tumour cells in peripheral blood correlates with 5-year survival. Our results suggest a prognostic value of this method. Nevertheless, prospective analysis of a larger cohort is needed to determine the ultimate value of RT-PCR for tyrosinase in blood testing.
Melanoma
Res 2005 Dec
PMID:Five-year results of prognostic value of tyrosinase in peripheral blood of uveal melanoma patients. 1631 35
The human endogenous retrovirus-K encodes two potential tumor proteins, Rec and Np9. Rec is related to the Rev protein of HIV-1 and has been shown to be associated with tumor development in nude mice. Having shown the expression of human endogenous retrovirus-K in human melanomas and melanoma cell lines, tools were developed to allow the expression of the transmembrane envelope, Rec and Np9 mRNA and proteins to be studied in more detail. The expression of spliced env, rec and np9 was investigated by
reverse transcriptase
-polymerase chain reaction using a set of primers developed to discriminate between full-length and spliced mRNA. Env-specific, Rec-specific and Np9-specific antisera were produced, characterized and used to study protein expression in melanomas and melanoma cell lines by immunohistochemistry, immunofluorescence and Western blot analyses. Existence of human endogenous retrovirus-K Rec and Np9-specific antibodies in the sera of melanoma patients were analyzed by Western blot of immunofluorescence studies. The expression of both spliced env and rec mRNA was detected in 39% of the melanomas and in 40% of the melanoma cell lines and np9 mRNA was detected in 29 and 21%, respectively. In normal neonatal melanocytes, spliced rec mRNA was detected in the absence of spliced env mRNA. Using antisera specific for Rec and Np9, Rec protein was found in 14% of the melanomas but Np9 in none. In addition, cell surface expression of the putatively immunosuppressive transmembrane envelope protein and release of virus particles were shown. Antibodies specific for neither Rec nor Np9 were detected. The transmembrane envelope protein, Rec and Np9 proteins are expressed in melanoma cells with a pattern similar to that seen in teratocarcinoma cell lines. Additional experiments are needed to determine their involvement, if any, in cell proliferation and tumor progression.
Melanoma
Res 2006 Jun
PMID:Expression of the human endogenous retrovirus-K transmembrane envelope, Rec and Np9 proteins in melanomas and melanoma cell lines. 1671 69
Endothelin (ET)-1 is an autocrine/paracrine growth factor or an antiapoptotic factor in human cancers, and blockade of ET-1 receptors can sensitize human tumor cells to apoptosis. The role of the ET-1 axis in the proliferation and/or apoptosis of melanoma cells and in their response to the alkylating agent, dacarbazine (DTIC), used in clinical treatment of human melanoma were investigated in five human melanoma cell lines obtained form surgical resection specimens.
Melanoma
cells expressed the messenger RNAs (mRNAs) for the components of the ET-1 axis. ET-1 binding was mediated by ET(B) but was inhomogeneous among melanoma cells. Exogenous ET-1 did not induce human melanoma cell proliferation. Bosentan, a dual ET(A/B)-receptor antagonist, decreased melanoma cell viability and DNA synthesis and induced melanoma cell apoptosis in defined human melanoma cells. Bosentan potentiated Fas ligand-induced apoptosis only in one melanoma cell line. Variants of ET(B)were determined using
reverse transcriptase
(RT) polymerase chain reaction (PCR) and primers spanning the whole sequence of the ET(B)gene. ET(B)variants were demonstrated only in one of the five cell lines, corresponding to the absence of ET-1 binding by these cells. Bosentan did not inhibit the effects of alkylating agents, and the effects of bosentan and alkylating agents were additive in melanoma cells. In conclusion, exogenous ET-1 is not a growth factor for human melanoma cells, but blockade of ET receptors decreases proliferation, induces apoptosis, and potentiates the effects of anticancer agents in defined melanoma cells, suggesting that combination therapy of ET-receptor antagonists with alkylating agents may improve their efficacy.
...
PMID:Targeting the endothelin axis in human melanoma: combination of endothelin receptor antagonism and alkylating agents. 1674 Oct 59
We have reported a high prevalence of hypothyroidism in the cutaneous melanoma population, suggesting that the pathologic hormonal environment of hypothyroidism promotes melanoma growth. The objective of this study was to test the hypothesis that TSH, which circulates at elevated levels in hypothyroid individuals, stimulates the growth of melanoma cells. Our results show that TSH receptors (TSHR) are expressed by virtually all cutaneous melanocytic lesions, including benign nevi, dysplastic nevi, and melanomas, with higher expression found in malignant and pre-malignant lesions. The finding of TSHR expression by human tumors is confirmed in cultured melanoma cells and melanocytes, in which TSHR expression is demonstrated by immunofluorescent staining, western blotting, and
reverse transcriptase
-PCR.
Melanoma
TSHR are functional, as evidenced by the ability of TSH to induce the formation of cAMP and to activate the mitogen-activated protein kinase (MAPK) pathway. Cultured melanoma cells, but not melanocytes, are induced to proliferate at a physiologically relevant concentration of TSH. Taken together, these data support the hypothesis that TSH is a growth factor for human melanoma. Our findings have broad clinical implications for the prevention of melanoma and the management of established disease.
...
PMID:Human melanoma cells express functional receptors for thyroid-stimulating hormone. 1715 70
A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by
reverse transcriptase
-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of
reverse transcriptase
-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with
reverse transcriptase
-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by
reverse transcriptase
-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.
Melanoma
Res 2007 Apr
PMID:Prognostic role of circulating melanoma cells detected by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA in patients with melanoma. 1749 83
<< Previous
1
2
3
4
5
Next >>