Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.7.49 (reverse transcriptase)
 31,746 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

An oncornavirus isolated from a squirrel monkey (Saimiri sciureus) lung culture has a density of 1.16 to 1.17 grams per milliliter, contains 70S RNA, and has an RNA-directed DNA polymerase that prefers Mg2+ over Mn2+ in an assay in which polyribocytidylate - oligodeoxyguanylate (12-18) is used as a synthetic template. Morphologically, the virus resembles Mason-Pfizer monkey virus but is antigenically distinct from this virus. The virus grows in cells of human, chimpanzee, rhesus monkey, canine, and mink origin, but not cells of squirrel monkey origin. On the basis of its properties, the newly isolated virus can be classified as a retravirus.
 ...
PMID:Oncornavirus: isolation from a squirrel monkey (Saimiri sciureus) lung culture. 6 93

Rauscher leukemia virus RNA-directed DNA polymerase has been purified to near homogeneity (greater than 90% pure) using affinity chromatography on polycytidylate-agarose with over 85% recovery of input enzymatic activity. The purified enzyme has a molecular weight of approximately 70,000 and appears to consist of a single polypeptide chain. The enzyme is free of DNase, but has RNase H activity. Analysis of the requirements for optimal rates of DNA synthesis by this enzyme using synthetic and natural template-primers has revealed template-specific variations in such requirements. During these studies it was observed that DNA synthesis catalyzed by Rauscher leukemia virus DNA polymerase is inhibited by the addition of inorganic phosphate. An analysis of the mechanism of phosphate inhibition was carried out using the synthetic template-primer poly(A)-(dT)10. It appears that by some mechanism, possibly involving the substrate binding site of the enzyme, phosphate ions inhibit DNA synthesis with a more acute effect on the rate of chain growth than on that of initiation. The extension of these studies to DNA synthesis catalyzed by a variety of mammalian type C viral reverse transcriptases revealed that low levels ( less than or equal to 2 mM) of inorganic phosphate strongly inhibited DNA synthesis. The susceptibility to phosphate inhibition appears unique to mammalian type C viral enzymes since the type B viral enzyme, Escherichia coli DNA polymerase I, avian myeloblastosis virus and Mason Pfizer monkey tumor virus reverse transcriptase and cellular DNA polymerases alpha and gamma are not inhibited by inorganic phosphate. This phenomenon of phosphate inhibition of various DNA polymerases, therefore, provides a new basis for the differentiation of the sources and nature of these enzymes.
 ...
PMID:Purification and properties of Rauscher leukemia virus DNA polymerase and selective inhibition of mammalian viral reverse transcriptase by inorganic phosphate. 6 68

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
 ...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84

High-performance steric exclusion chromatography on a 1250-A pore size polyethylene glycol-treated glass bead column was used to purify avian myeloblastosis virus and hamster melanoma virus from plasma protein and tissue culture media. The purified hamster melanoma virus was still infectious and the avian myeloblastosis virus-associated RNA-directed DNA polymerase showed a 1100-fold purification of the virus from one column treatment. Electron microscopy of the purified virus showed intact particles, with surface projections evident. The time required for column purification of the virus was 5 min.
 ...
PMID:Rapid purification of an RNA tumor virus and proteins by high-performance steric exclusion chromatography on porous glass bead columns. 6 20

The RNA-directed DNA polymerase of murine mammary tumor virus, a type B RNA tumor virus, was purified sequentially through DEAE-cellulose, phosphocellulose (step gradient), and phosphocellulose (linear salt gradient) chromatography followed by glycerol sedimentation centrifugation. During all stages of purification, coincident peaks of RNA-directed DNA polymerase activity, templated by polyribocytidylate-oligodeoxyguanidylate, and RNase H digestion of [3H]polyriboadenylate-polydeoxythymidylate were observed, and both enzymatic activities displayed a cation preference for magnesium. Under conditions that removed adventitiously associated nucleases, RNase H activity was found to co-purify with polymerase. The specificity of this nuclease was assayed with various prepared substrates, which indicated that the polymerase-associated RNase H activity was directed only against the RNA strand of an RNA-DNA hybrid. It is highly probable that RNase H (RNA-DNA hybrid: ribonucleotide-hydrolase, EC 3.1.4..34) and RNA-directed DNA polymerase of type B viruses are associated enzymatic activities analogous to those observed for avian and mammalian type C RNA tumor viruses.
 ...
PMID:RNase H and RNA-directed DNA polymerase: associated enzymatic activities of murine mammary tumor virus. 6 21

We have analyzed the DNA products synthesized in vitro in reconstructed reactions containing purified avian oncornavirus genome RNA and RNA-directed DNA polymerase. The results of these studies indicate that: (i) the initial DNA product synthesized on either 70S RNA or reconstituted 35S RNA-tRNAtrp template - primer complexes in the presence of low concentrations of deoxynucleoside triphosphates consists of several discrete size classes, none of which exceed 200 nucleotides in length; (ii) large DNA transcripts (about 2,000 nucleotides) can be synthesized on both 70S RNA and the 35S RNA - tRNAtrp complex by increasing the deoxynucleoside triphosphate concentration; and (iii) DNA synthesized by detergent-disrupted virus is considerably longer than DNA synthesized in reconstructed reactions.
 ...
PMID:In vitro transcription of theavian oncornavirus genome by the RNA-directed DNA polymerase: analysis of DNA transcripts synthesized in reconstructed enzymatic reactions. 6 24

Transcription of DNA from the RNA genome of avian sarcoma virus by RNA-directed DNA polymerase in vitro initiates on a primer (tRNATrp) located near the 5'-terminus of the viral genome. One of the major products of transcription is a single-stranded DNA chain complementary to a sequence of 101 nucleotides immediately distal to the site of initiation of DNA synthesis. We have determined the complete nucleotide sequence of this transcribed chain for the Prague strain of avian sarcoma virus, a partial sequence of the transcribed chain for the Bratislava 77 strain of avian sarcoma virus, and the sequence of a DNA transcript that is shorter than the transcribed single-stranded chain. Our data define the location of tRNATrp on the genome of avian sarcoma virus and provide the sequence of 119 nucleotides at the 5'-terminus of the genome. Portions of this sequence may be involved in the binding of RNA-directed DNA polymerase, the initiation of translation from viral messenger RNA, the extension of RNA-directed DNA synthesis from the 5'- to the 3'-terminus of viral RNA, and the integration of viral DNA into the host genome.
 ...
PMID:Nucleotide sequence at the 5' terminus of the avian sarcoma virus genome. 6 1

An RNA-directed DNA polymerase was found to be associated with intracytoplasmic A-particles from DBA/2 mouse leukemia cells. The enzyme activity was detected after disrupting the purified particles with 2 M NaCl-20 mM dithiothreitol. The presence of a divalent cation and all four deoxyribonucleoside triphosphates was essential for this enzyme activity. The enzyme had a clear preference for Mg2+ over Mn2+. Cesium sulfate isopycnic gradient centrifugation of the DNA product synthesized in the actinomycin D-containing reaction revealed the presence of DNA-RNA hybrid. Furthermore, the purified DNA product was found to hybridize with RNA isolated from A-particles. These observations strongly indicate that the endogenous A-particle RNA serves as the template for the DNA polymerase.
 ...
PMID:Characterization of an RNA-directed DNA polymerase found in association with murine intracytoplasmic A-particles. 6 24

The minus-strand component of double-stranded DNA synthesized by the avian oncornavirus RNA-directed DNA polymerase in vitro represents as much of the nucleotide sequences of the viral genome as single-stranded DNA synthesized in the presence of actinomycin D. Since actinomycin D inhibits doublestranded DNA formation, we propose that the principal effect of the drug on RNA-directed DNA synthesis is the reduction in synthesis of plus-strand DNA, thereby allowing single-stranded minus-strand DNA to accumulate. This effect, rather than increasing the extent of genome transcription, is responsible for the more uniform nature of the DNA transcripts synthesized in the presence of actinomycin D.
 ...
PMID:In vitro transcription of the avian oncornavirus genome by the RNA-directed DNA polymerase: effect of actinomycin D on the extent of transcription. 6 22

The initiation of DNA synthesis in vitro by RNA-directed DNA polymerase (deoxynucleosidetriphosphate: DNA deoxynucleotidyltransferase, EC 2.7.7.7) of avian oncornaviruses requires a tRNAtrp primer molecule located close to the 5' end of the viral RNA genome. DNA transcripts, 100 nucleotides in length, initiated on the tRNAtrp primer molecule contain nucleotide sequences complementary to a large (25 nucleotides) RNase T1 oligonucleotide, T-13, located at the 5' terminus of the avian sarcoma virus RNA genome. tRNAtrp-initiated DNA transcripts with a length of about 70 nucleotides contain substantially fewer nucleotide sequences complementary to this 5'-terminal oligonucleotide, suggesting that the tRNAtrp primer associated with the avian sarcoma virus RNA is located approximately 100 nucleotides from the 5' end of the RNA. In addition, we present evidence to demonstrate that DNA transcribed from avian sarcoma virus RNA sequences located at the 3' end, immediately adjacent to the poly(A), contains nucleotide sequences that are complementary to the 5'-terminal T1 oligonucleotide T-13. These data indicate that the 5' end of the viral genome contains nucleotide sequences that are repeated at the 3' end of the genome. We conclude that the avian oncornavirus RNA genome is terminally redundant.
 ...
PMID:Terminally repeated sequences in the avian sarcoma virus RNA genome. 7 37


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>