Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound   Target Concepts: Gene/Protein Disease Symptom Drug Enzyme Compound

---

Query: EC:2.7.7.49 (reverse transcriptase)
31,746 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

The influence of Rous sarcoma virus (RSV)-associated RNase H on the in vitro synthesis of DNA by the RSV RNA-directed DNA polymerase was determined under conditions whereby RNase H activity was selectively inhibited with NaF. Not only were we unable to detect any effect on the size, structure, or genetic complixity of the DNA product synthesized in the absence of RNase H activity, but the displacement of DNA from the 70S RNA:DNA hybrid structures was also unaffected. The suitability of 70S RNA:DNA hybrid structures synthesized in vitro to serve as a substrate for RNase H is discussed.
...
PMID:In vitro transcription of 70S RNA by the RNA-directed DNA polymerase of Rouse sarcoma virus: lack of influence of RNase H. 5 43

The major species of primer RNA required for the initiation of DNA synthesis by the Rous sarcoma virus RNA-directed DNA polymerase can be aminoacylated by tryptophan. Furthermore, an intact 3' terminus is required for the primer to function in the initiation of DNA synthesis.
...
PMID:Initiation of DNA synthesis by the avian oncornavirus RNA-directed DNA polymerase: tryptophan tRNA as the major species of primer RNA. 5 57

Cocultivation of cells derived from embryos of golden pheasants or Amherst pheasants with chicken embryo cells infected with Bryan strain of Rous sarcoma virus resulted in the detection of viruses which appear to be endogenous in these pheasant cells. The pheasant viruses (PV) were similar to avian leukosis-sarcoma viruses (ALSV) in their gross morphology, in the size of their RNA, in the presence of a virion-associated RNA-dependent DNA polymerase (DNA nucleotidyltransferase; deoxynucleoside triphosphate: DNA deoxynucleotidyltransferase; EC 2.7.7.7), and in their growth characteristics. PV also serves as a helper for the glycoprotein-defective Rous sarcoma virus. However, PV was shown to be different from both ALSV and reticuloendotheliosis virus in the following properties: (i) PV does not have ALSV group specific antigens; (ii) the protein composition of PV is different from those of the other two groups of viruses; (iii) PV fails to complement the defective polymerase of alpha type Rous sarcoma virus; and (iv) PV RNA shows no detectable homology with nucleic acids of the other two groups of viruses. Thus, PV appears to be a new class of RNA viruses which contain RNA-dependent DNA polymerase.
...
PMID:Pheasant virus: new class of ribodeoxyvirus. 5 21

A new rifamycin derivative, rifazone-82 (R-82), an inhibitor of viral RNA-dependent DNA polymerase, is selectively toxic to transformed chicken cells in culture. R-82 has now been shown to possess antiviral activity as well. The relatively nontoxic properties of R-82 to nontransformed cells have permitted the execution of experiments examining the effect of a rifamycin derivative on virus reproduction. Addition of low concentrations of R-82 (15 mug/ml) to cultures soon after Rous sarcoma virus infection prevents the spread of infection thoroughout the culture. This inhibition is not dependent on concomitant cellular transformation as identical results were obtained with cells infected with a transformation-defective Rous sarcoma virus. Addition of R-82 to cultures in which all the cells are infected does not substantially affect the yield of physical particles as measured by RNA-dependent DNA polymerase activity and by (3H) uridine incorporation into viral RNA. However, the infectivity of the progeny virus, as measured by focus-forming ability, is decrreased 95 to 99% by R-82 treatment.
...
PMID:Inhibition of infectious Rous sarcoma virus production by rifamycin derivative. 5 73

Cells doubly infected with two mutants of the Schmidt-Ruppin strain of Rous sarcoma virus (RSV), ts68, which is temperature sensitive for cell transformation (srcts), and a deletion mutant, N8, which is deficient in the envelope glycoprotein (env-), produced a recombinant which carried the defects of both parents. The frequency of formation of such a recombinant was exceptionally high and made up 45 to 55% of the progeny carrying the srcts marker. By contrast, the reciprocal recombinant, which is wild type in transformation (srcts) and contains the subgroup A envelope glycoprotein (envA), was almost undetectable. This remarkable difference in the frequency of the formation of the two possible recombinants suggests that a unique mechanism may be involved in the genetic interaction of the two virus genomes, one of which has a large deletion. When an RNA-dependent DNA polymerase-negative variant of the N8 (N8alpha) was crinants also became deficient in the polymerase. Cells infected by the srctsenv- recombinant were morphologically normal at the nonpermissive temperature (41 degrees C) and susceptible to all subgroups of RSV. The rate by which the wild-type RSV transformed the recombinant-preinfected cells was indistinguishable from that of transformation of uninfected chicken cells by the same wild-type virus. This indicates that no detectable interference exists at postpenetration stages between the preinfected and superinfecting virus genomes and confirms that the expression of the transformed state is dominant over the suppressed state.
...
PMID:Recombination between a temperature-sensitive mutant and a deletion mutant of Rous sarcoma virus. 6 Apr 96

An RNA-directed DNA polymerase associated with transformation-defective (td) segregant of Rous sarcoma virus (RSV) has been characterized. The enzyme required both a monovalent and a divalent cation, a sulfhydryl reducing agent, and all four deoxyribonucleoside triphosphates for the expression of maximal activity. Sensitivity of the endogenous RNA-directed DNA polymerase activity to a low concentration of pancreatic RNase indicated that the enzyme utilized the td virus endogenous RNA as template. Maximal DNA synthesis was observed in a reaction mixture of pH 8 - 8.5 at 45 C with a manganese concentration of 1 mM. The enzyme of the td virus responded to exogenous template-primers in a manner characteristic of DNA polymerase of RNA tumor viruses, and the response became substantially greater when noncomplementary precursors were omitted from the reaction mixture. The endogenous reaction kinetics were examined. Three phases of DNA synthesis could be distinguished. Evidence was obtained showing that during the third and slowest phase of DNA synthesis the reaction mixture was not depleted of precursors and that the enzyme was fully active to initiate DNA synthesis with newly-added viral or synthetic RNA templates. Comparison of TMP and dAMP incorporation kinetics suggested that at the initial phase the enzyme preferentially copies A-rich region(s) of viral RNA. A comparison was also made between the endogenous reaction of the td virus and that of its parent sarcoma virus. The pH optimum, metal ion requirements, effect of sulfhydryl agents, response to exogenous template-primers, and kinetics of DNA synthesis, were all compared. No significant difference between the reaction of the td virus and its sarcomatogenous counterpart could be demonstrated.
...
PMID:Endogenous DNA polymerase of a transformation-defective rous sarcoma virus: characterization and comparison with the enzyme of the non-defective parent. 6 91

The alpha, beta2, and alphabeta forms of the RNA-dependent DNA polymerase of avian sarcoma virus B77 grown in duck embryo fibroblasts have been compared with respect to several kinetic properties. The following results were obtained. 1. The Km values for dTTP and dGTP for enzyme forms alpha, beta2, and alphabeta were 77, 39, and 74, and 6.8, 3.1, and 6.1 micronM, respectively. 2. The affinity of 70 S Rous sarcoma virus RNA for enzyme form alphabeta was about twice that for the other two forms. 3. The relative specific activities of the three enzyme forms on synthetic primer-templates such as poly(rA)-poly(dT) were almost the same. The viral 70 S RNA-dependent specific activities were 2 to 3 orders of magnitude lower and in the ratio of 1:3:5 for enzyme forms alpha:beta2:alphabeta. Addition of exogenous oligo(dT) stimulated the 70 S viral RNA-dependent activity of enzyme forms alphabeta and beta2 by a factor of 3, and that of enzyme form alpha by a factor of 30, so that it then became the most active transcriptase of viral 70 S RNA. 4. The largest transcripts formed by the three enzyme forms with 70 S viral RNA as primer-template were about 4,500 nucleotides long. About one-third of the total amount of polynucleotides polymerized by the alphabeta enzyme was in the form of such transcripts. This proportion was far higher than for the other two enzyme forms. 5. All three enzyme forms were capable of transcribing single-stranded into double-stranded DNA. 6. The 3-propylcyclohexyl piperidyl derivative of rifamycin SV, at a concentration of 100 microng/ml, inhibited enzyme forms beta2 and alphabeta by over 99.5 and 96%, respectively, but enzyme form alpha by only about 60%. 7. The beta2 and alphabeta forms of the enzyme were processive DNA polymerases, the alpha form a nonprocessive polymerase. 8. In general, these results indicate that in most respects the properties of the dimeric enzyme forms resemble each other much more closely than those of the alpha form. In some very important respects, such as affinity for viral RNA and the size of transcripts formed from it, the alphabeta enzyme form performs significantly better than either of the other two enzyme forms.
...
PMID:RNA-dependent DNA polymerase of avian sarcoma virus B77. II. Comparison of the catalytic properties of the alpha, beta2, and alphabeta enzyme forms. 6 35

When Rous sarcoma virus RNA is transcribed into DNA by the reverse transcriptase, a tRNA primer is elongated into DNA. The primer is near the 5' end of the virus genome; the first major DNA made is a "run-off" product extending 101 bases from the primer to the 5' end of the template. We have studied this DNA molecule to determine the sequence of the first 101 bases at the 5' end of the Rous sarcoma virus genome (Prague strain, subgroup C). Twenty-one bases at the extreme 5' end are also at the 3' end of the virus genome (see D. E. Schwartz, P. C. Zamecnik, and H. L. Weith, this issue, pp. 994-998), and thus this virus is terminally redundant. The existence of this sequence repetition immediately suggests mechanisms by which the growing DNA copy can jump from the 5' end to a 3' end of the template and become circular. The sequence also displays a possible ribosome binding site and enough secondary structure to permit a possible 5'-5' linkage of viral RNA molecules.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 5' sequence. 6 83

A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified reverse transcriptase (RNA-directed DNA polymerase; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W. Gilbert, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by reverse transcriptase which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84

Northern poke lymphosarcoma DNA polymerase was partially purified from particulate fractions banding at 1.15 to 1.16 g/ml from homogenates prepared from frozen necropsies of tumor-bearing pike. The enzyme behaves as a typical reverse transcriptase, in that it prefers ribotemplates to deoxytemplates. The isoelectric point (pl 5.5) is similar to that of avian myeloblastosis virus polymerase. The pike enzyme elutes from a phosphocellulose column at 0.22 M potassium phosphate, the same as avian myeloblastosis virus DNA polymerase. The enzyme activity is inhibited by pyran, a specific inhibitor of viral DNA polymerases. The most striking difference between the pike lymphoma polymerase and the other viral DNA polymerases tested is the low maximum temperature of 20 degrees, compared to 30 degrees for Rauscher leukemia virus polymerase and 38 degrees for avian myeloblastosis virus and Rous sarcoma virus.
...
PMID:Presence of DNA polymerase in lymphosarcoma in northern pike (Esox lucius). 6 92


<< Previous 1 2 3 4 5 6 7 8 9 10 Next >>

---