Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.7.49 (
reverse transcriptase
)
31,746
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
A sequence of 20 nucleotide residues immediately adjacent to the 3'-terminal poly(A) in Rous sarcoma virus (Prague strain, subgroup C) 35S RNA has been determined by extension of a riboguanylic acid-terminated oligothymidylic acid primer hybridized at the 5' end of the 3'-terminal poly(A) with purified
reverse transcriptase
(
RNA-directed DNA polymerase
; deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC 2.7.7.7) from avian myeloblastosis virus. The sequence is 5'GCCAUUUUACCAUUCACCACpoly(A)3'. This same nucleotide sequence, excluding the poly(A) segment, has also been found at the 5' terminus of Rous sarcoma virus RNA (W. A. Haseltine, A. Maxam, and W.
Gilbert
, this issue pp. 989-993), and therefore the RNA genome of this virus is terminally redundant. Possible mechanisms for endogenous in vitro copying of the complete RNA genome by
reverse transcriptase
which involve terminally repeated nucleotide sequences are discussed.
...
PMID:Rous sarcoma virus genome is terminally redundant: the 3' sequence. 6 84
We have determined the terminal heteropolymeric sequences of AMV RNA by the following procedures: first, RNA sequence determination on the 5' terminal and the poly(A)-linked 3' terminal T1 oligonucleotides, and second, analysis by the Maxam and
Gilbert
(1977) method of AMV strong stop DNA and of DNA complementary to the poly(A)-linked T1 oligonucleotide, synthesized with
reverse transcriptase
and (pdT)13 as primer. The structure deduced for the 5' terminal region is (5')7mGpppGmCCAUUCUACCUCUCACCACAUUGGUGUGCACCUGGGUUGAUGGCCGGACCGUCGAUUCCCUGACGACUACGAGCACCUGCAUGAAGCAGAAGGCUUCAU... Two distinct 3' terminal sequences were deduced: GCCAUUCUACCUCUCAAA...AOH and GCCAUUCUACCUCUCACCAAA...AOH. The two termini, differing by a C-C-A sequence, may reflect genetic heterogeneity of the AMV stock or, more probably, may be generated at or after RNA transcription. These results demonstrate a terminal redundancy of the hetero polymeric sequence of 16 and 19 nucleotides, respectively. The terminal redundancy allows for mechanisms which involve transfer of the DNA segment synthesized on the 5' terminal redundant sequence to the 3' terminal redundant sequence.
...
PMID:Avian myeloblastosis virus RNA is terminally redundant: implications for the mechanism of retrovirus replication. 19 42
The nucleotide sequence of the entire 5' untranslated region of human gamma-globin mRNA has been determined. This was accomplished by analyzing complementary DNA (cRNA) synthesized from the mRNA with
reverse transcriptase
. The CDNA was labeled at its 3' end with 32"p using terminal deoxynucleotidyl transferase, digested with the restriction endonuclease Hae III and the end-labeled fragment isolated ans sequenced by the method of Maxam and
Gilbert
. Including the initiation codon AUG, the 5' untranslated region of human gamma-globin mRNA contains 57 nucleotides, compared to 41 in alpha- and 54 in beta-globin mRNA. There is very little homology between alpha and gamma sequences in the 5' region. There is considerable homology between beta- and gamma-globin mRNAs in the regions proximal and distal to the initiation codon, but the entire sequence shows less homology than the human and rabbit beta-globin mRNAs. The hexanucleotide sequence CUUCUG is found near the 5' ends of all three human globin mRNAs, suggesting a possible role of this sequence or ribosomal binding. Both guanosine and cytidine were found at the 19th nucleotide position from the 5' end of the gamma mRNA. We believe this heterogeneity arises from the difference in nucleotide sequence between the A gamma and G gamma loci.
...
PMID:The nucleotide sequence of the 5' untranslated region of human gamma-globin mRNA. 31 62
An ovine mammary cDNA library has been constructed from total poly(A)+ RNA isolated from the mammary gland of a lactating ewe, using a classical procedure. Blunt-ended double-stranded cDNAs prepared with
reverse transcriptase
and nuclease S1 were tailed with dCTP, inserted into the dGMP-tailed PstI site of plasmid pBR322 and cloned in E. coli. Five series of homologous clones representing abundant messenger RNAs (strong hybridization with a single-stranded cDNA probe generated from total poly(A)+ RNA) were selected using each time a different predominant cloned ds-cDNA as probe, then identified by positive hybridization-translation of the cognate mRNA and subsequent immunoprecipitation and electrophoresis of the protein. The lengths of alpha s1-, alpha s2-, beta-, kappa-casein and beta-lactoglobulin mRNAs are in the range of 1.2, 1.1, 1.25, 1.0 and 0.85 kb, respectively, as determined by Northern blotting analysis. Five homologous mRNAs of similar sizes were identified in the porcine species by dot blot hybridization and Northern analyses. The nucleotide sequence of alpha s1-casein mRNA was determined by sequencing, according to Maxam and
Gilbert
, both a 1080 bp long cloned ds-cDNA and a ss-cDNA (268 nucleotides) generated by 5' extension of a 5' terminal truncated radiolabeled fragment (83 bp) of the relevant ds-cDNA, used as primer for reverse transcription. The 3' non coding region (431 nucleotides, excluding the poly(A) tail) represents 70% of the length of the coding region (618 nucleotides) flanked by a 61 nucleotide 5' region. Comparison of sequences of ovine and bovine, rat and guinea-pig alpha s1-casein mRNAs has revealed a greater homology in the 3' and especially 5' non coding regions. In the reading frame, the conserved regions are essentially those corresponding to the signal peptide and phosphopeptide domains. The derived 206 amino acid sequence of ovine pre-alpha s1-casein differs from that of its bovine counterpart (genetic variant B) by 24 amino acid substitutions and a deletion of 8 amino acid residues occurring in the polypeptide chain of the mature protein. Such a variation (84% homology only) in two phylogenetically closely related species indicates a high rate of evolution of alpha s1-casein.
...
PMID:Construction and identification of recombinant plasmids carrying cDNAs coding for ovine alpha S1-, alpha S2-, beta-, kappa-casein and beta-lactoglobulin. Nucleotide sequence of alpha S1-casein cDNA. 300 1
The location of unpaired adenine residues within the secondary structure of rabbit 18S ribosomal RNA was determined by chemical probing. Naked 18S rRNA was first prepared by digestion of purified 40S subunits with matrix-bound proteinase K in sodium dodecyl sulfate, thereby omitting the use of nucleic acid denaturants. Adenines within naked 18S rRNA were chemically probed by using either diethyl pyrocarbonate or dimethyl sulfate, which specifically react with unpaired nucleotides [Peattie, D. A., &
Gilbert
, W. (1980) Proc. Natl. Acad. Sci. U.S.A. 77, 4679-4682]. Adenine modification sites were identified by polyacrylamide sequencing gel electrophoresis either upon aniline-induced strand scission of 32P-end-labeled intact and fragmented rRNA or by primer extension using sequence-specific DNA oligomers with
reverse transcriptase
. The data indicate good agreement between the general pattern of adenine reactivity and the location of unpaired regions in 18S rRNA determined by comparative sequence analysis [Chan, Y.-L., Gutell, R., Noller, H. F., & Wool, I. G. (1984) J. Biol. Chem. 259, 224-230]. The overall reactivity of adenine residues toward single-strand-specific chemical probes was, also, similar for both rabbit and Escherichia coli small rRNA. The number of strongly reactive adenines appearing within phylogenetically determined helical segments, however, was greater in rabbit 18S rRNA than for E. coli 16S rRNA. Some of these adenines were found clustered in specific helices. Such differences suggest a greater irregularity of many of the helical elements within mammalian 18S rRNA, as compared with prokaryotic 16S rRNA. These helical irregularities could be important for protein association and also may represent biologically relevant flexible regions of the molecule.
...
PMID:Chemical probing of adenine residues within the secondary structure of rabbit 18S ribosomal RNA. 334 49
The naturally occurring modified nucleoside 3-[3-amino-3-carboxypropyl]-1-methylpseudouridine (abbreviated am psi) is found in eukaryotic 18S rRNA. We localized am psi to sequence resolution in D. melanogaster 18S rRNA. This hypermodified base causes an absolute stop in cDNA elongation. The RNA sequence bearing am psi was determined by dideoxy-sequencing with
reverse transcriptase
. The rDNA coding for this part of the 18S rRNA was sequenced by the Maxam-
Gilbert
method. Together these two sequencing methods can be used to position the cDNA stop (am psi) in the rRNA sequence. Chemical evidence for the existence of am psi in this RNA sequence was obtained by high-performance liquid chromatography (HPLC) of 18S rRNA nucleosides from radioactive-labeled cells. L-[2-14C] methionine will selectively label am psi in eukaryotic 18S rRNA. Using HPLC, we found a single 14C-labeled nucleotide in digests of 18S rRNA. This nucleotide is in the RNA sequence bearing the cDNA stop since a restriction fragment which hybridizes to this sequence protects the modified base from RNase T1 digestion.
...
PMID:A sequence from Drosophila melanogaster 18S rRNA bearing the conserved hypermodified nucleoside am psi: analysis by reverse transcription and high-performance liquid chromatography. 616 94
The complete 5'-terminal nucleotide sequence of the MRNA coding for the bovine common precursor of corticotropin and beta-lipotropin has been determined. The 5'-32P-labelled, 21-nucleotides-long, single-stranded DNA fragment complementary to a portion of the 5'-noncoding region of the mRNA was prepared from a cDNA clone and elongated by
reverse transcriptase
reaction with the mRNA as template. The DNA transcript formed was sequenced by the procedure of Maxam and
Gilbert
, and the resultant sequence was cross-checked by two-dimensional electrophoretic analysis of the partial alkaline digest of the 5'-32P-labelled mRNA. The 5'-terminal nucleotide residue was determined by two-dimensional thin-layer chromatography of the complete hydrolysis product of the 5'-32P-labelled mRNA. The nucleotide sequence determined, which partially overlaps the known sequence of the cloned cDNA, reveals the complete 5'-terminal sequence of the mRNA. This, in conjunction with our previous data, defines the complete primary structure of the mRNA. The mRNA is composed of 1098 nucleotides, including an unusually long 5'-noncoding sequence of 128 nucleotides. The presence of a 'cap' structure at the 5' terminus of the mRNA is suggested. The 5'-terminal 48 nucleotide residues of the mRNA are extremely purine-rich, having an A + G content of 83%, whereas all pyrimidine-rich segments are located downstream from there. Because the 5'-noncoding region of the mRNA contains three segments of potential secondary structure which partially overlap, it can exist in a number of alternative base-pairing configurations. However, its interaction with the 3'-terminal segment of 18-S rRNA at the site of maximal complementarity would fix the mRNA configuration in such a way as to bring the possible site of ribosome binding near the initiation codon.
...
PMID:5'-terminal nucleotide sequence of the messenger RNA coding for bovine corticotropin/beta-lipotropin precursor. 626 Apr 86
The nucleotide sequence of an EcoRI duck hepatitis B virus (DHBV) clone was elucidated by using the Maxam and
Gilbert
method. This sequence, which is 3,021 nucleotides long, was compared with the two previously analyzed hepatitis B-like viruses (human and woodchuck). From this comparison, it was shown that DHBV is derived from an ancestor common to the two others but has a slightly different genomic organization. There was no intergenic region between genes 5 and 8, which were fused into a single open reading frame in DHBV. Genes for the surface and core proteins were assigned to open reading frames 7 and 5/8. Amino acid comparisons showed some structural relationship between gene 6 product and avian
reverse transcriptase
, suggesting either evolution from a common ancestor or convergence to some particular structure to fulfill a specific function. This should be correlated with the synthesis of an RNA intermediate during DNA replication. This is also taken as an argument in favor of the hypothesis that gene 6 codes for the DNA polymerase that is found within the virion. DNA sequence comparison also showed that the two mammalian hepatitis B viruses are more homologous to each other than they are to DHBV, indicating that DHBV starts to evolve on its own earlier than the two other viruses, as do birds compared with mammals. From this it is proposed that the viruses evolved in a fashion parallel to the species they infect.
...
PMID:Nucleotide sequence of a cloned duck hepatitis B virus genome: comparison with woodchuck and human hepatitis B virus sequences. 669 38
mRNA was isolated from the thoracic aortas of 16-day chick embryos and used to synthesize blunt-ended heteroduplex molecules consisting of one strand of mRNA and one of cDNA using AMV
reverse transcriptase
and S1 nuclease. The duplexes were tailed with dCTP and hybridized to the plasmid pBR322 which had been restricted with Pst I and tailed with dGTP. Recombinant plasmids were used to transform E. coli C600 and colonies containing elastin cDNA were selected by in situ hybridization with 32P labeled elastin mRNA and by hybrid selected translation using the nuclease-treated reticulocyte lysate system. mRNA recovered from hybridization to DNA of one clone, pWB1, markedly stimulated incorporation of [3H]valine into a protein which was immunoprecipitable with elastin-specific antibody and had a molecular weight of 72,000, characteristic of tropoelastin. The 230 bp insert of pWB1 was sequenced by the technique of Maxam and
Gilbert
and found to be derived from a nontranslated region of the 3' end of the mRNA. Nick-translated pWB1 was used to identify and to estimate the relative amounts of elastin mRNA in the developing chick embryo aorta by blot hybridization. A single mRNA species of 3.5 kb hybridized to the pWB1 probe and this species increased greatly in amount between day 7 and day 14. This increase was paralleled by an increase in translatable elastin mRNA and by the rate of elastin synthesis of aortas from various age embryos incubated in vivo. The injection of 150 microgram of hydrocortisone 21-phosphate into 8-day eggs produced a significant increase in both the relative rate of tropoelastin synthesized by the isolated aortas and the relative amount of elastin mRNA. These results suggest that the observed changes in elastin synthesis during development and after hydrocortisone administration are governed by the elastin mRNA content of the aortas.
...
PMID:Control of elastin synthesis. 708 85
A 25mer oligonucleotide containing a single N-(deoxyguanosin-8-yl-)-1-aminopyrene (dGAP), the major DNA adduct formed by reductively activated 1-nitropyrene, was synthesized. The adduct was located at nucleotide 21 from the 3' end. DNA synthesis on this template by human DNA polymerases alpha and beta, HIV
reverse transcriptase
, Sequenase (version 2.0) and Klenow fragment of DNA polymerase I was strongly blocked at the nucleotide 3' to the adduct site. Only when a 3'-->5' exonuclease-deficient Klenow fragment was used was incorporation of a nucleotide opposite the adduct observed. Nevertheless, extension beyond the adduct site did not occur to a significant extent. Only a relatively small proportion of full-length product (< 5%) was detected. In the presence of Mn2+, the efficiency of bypass with this polymerase increased. When a 20mer primer was elongated in the presence of only one nucleotide triphosphate, deoxycytidylic acid was preferentially incorporated opposite the adduct. Deoxycytidine opposite the adduct was also preferred when a set of 21mer primers (containing each of the four nucleotides opposite dGAP) were elongated to a full-length product in the presence of all four deoxynucleotide triphosphates. In order to confirm these results, extension of a 15mer primer was carried out with all four deoxynucleotide triphosphates and the products were isolated. Maxam--
Gilbert
sequencing of each elongation product showed that primer extension occurred in an error-free manner. We conclude that dGAP is a strong block of DNA replication. However, when translesion synthesis occurs, it is largely accurate.
...
PMID:DNA polymerase action on an oligonucleotide containing a site-specifically located N-(deoxyguanosin-8-yl)-1-aminopyrene. 772 60
1
2
Next >>