Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Pivot Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Target Concepts:
Gene/Protein
Disease
Symptom
Drug
Enzyme
Compound
Query: EC:2.7.11.1 (
protein kinase
)
81,284
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
We have investigated the mechanism of tolerance in a patient with
severe combined immunodeficiency
(
SCID
) transplanted with HLA-haploidentical, T cell-depleted bone marrow cells obtained from the mother. At 4 years after transplantation, T cells, natural killer (NK) cells, and a small percentage (2%) of B cells were found to be of donor origin, whereas monocytes and the majority of B cells remained of host origin. In primary mixed lymphocyte cultures (MLC), the engrafted T cells of the donor did not proliferate in response to the host cells, whereas untransplanted donor T cells showed good proliferative responses. However, CD4+ and CD8+ T-cell clones of donor origin with specificity for class II and class I HLA determinants of the host were isolated. CD8+, host-reactive T-cell clones displayed normal cytotoxic activity after stimulation with the host cells, but proliferative responses of CD4+, host-reactive T-cell clones were considerably reduced. In addition, both CD8+ and CD4+, host-reactive T-cell clones produced very low to undetectable levels of interleukin-2 (IL-2), IL-4, IL-5, IL-10, interferon-gamma, and granulocyte-macrophage colony-stimulating factor after specific antigenic activation, which may be responsible for their nonresponsive state in vivo. Expression of the CD3 zeta subunit of the T-cell receptor (TcR) was normal, and after stimulation via CD3,
Raf-1
and p42 mitogen activated protein (MAP) kinase were phosphorylated, indicating that this part of the signaling pathway after triggering of the TcR/CD3 complex is present. These results, together with our previous observation that dysfunctional, host-reactive T-cell clones can be isolated in
SCID
patients transplanted with fetal liver stem cells, demonstrate that lack of clonal deletion of host-reactive T cells is a general phenomenon after HLA-mismatched stem cell transplantation.
...
PMID:Dysfunctional cytokine production by host-reactive T-cell clones isolated from a chimeric severe combined immunodeficiency patient transplanted with haploidentical bone marrow. 770 97
Severe combined immunodeficiency disease
(
SCID
) of horses is an autosomal, recessive hereditary disease occurring among Arabian horses. The genetic defect responsible for this disease was recently identified as a 5-basepair deletion in the gene encoding DNA-
protein kinase
catalytic subunit (DNA-PKcs). Horses with one copy of the gene appear normal, while horses with two copies of the gene manifest the disease. The present report describes a PCR-based test for detection of the gene defect and the results from testing 250 randomly selected Arabian horses. The frequency of
SCID
gene carriers was 8.4% (21/250). Based on the gene frequency reported here, the authors would expect 0.18% (1 out of 567) of Arabian foals to be affected with
SCID
based on a random breeding population.
...
PMID:Frequency of the SCID gene among Arabian horses in the USA. 968 49
T cells are important effector cells in natural antiviral and anticancer immunity. It is important to reveal the cellular and molecular requirements for T cell differentiation and effector functions. We explored the idea that the final outcome of antigen receptor-driven immune processes is at least partially determined by physiologically abundant small signaling molecules in extracellular environment of lymphocytes in different tissues. Extracellular purines (ATP and adenosine) and their (purinergic) receptors were studied as an example of such molecules. Studies of functional effects of extracellular ATP and adenosine in immunoregulation have evolved in studies of individual molecules of purinergic receptors and of phosphorylation of extracellular domains of functionally important proteins. ATP-gated membrane pore, p2x 7(formerly p2z receptor) and A2a adenosine receptors are found to be predominantly expressed in T cells. The Gs-protein coupled A2a receptors activate
cAMP-dependent protein kinase
which was shown to have dual role in regulation of T cells functions. The results of our recent studies of adenosine receptors indicate that A2a receptors on T cell surface may play immunosuppressive role in conditions which lead to accumulation of extracellular adenosine. These conditions include pharmacological intervention with widely used anti-inflammatory drugs (methotrexate and sulfasalazine) and extracellular environment near large solid tumors. Hypoxic conditions in such tumors are known to cause accumulation of extracellular adenosine, which, in turn, as we have shown, could inhibit incoming antitumor cytotoxic T-lymphocytes from destroying the tumor. Normal development and functions of immune cells require adenosine deaminase (ADA) activity. Absence or low levels of ADA in humans result in
severe combined immunodeficiency
(
SCID
), which is characterized by hypoplastic thymus, T lymphocyte depletion, and autoimmunity. ADA
SCID
is currently explained only by intracellular lymphotoxicity of accumulated adenosine. We propose that T cell depletion, immunodeficiency, and autoimmunity could also be due to extracellular adenosine-induced signaling, which inhibits the antigen receptor (TCR) signaling and therefore affects the TCR-driven positive and negative selection of thymocytes. This, in turn, may lead to changes in antigen receptor repertoires and to immunodeficiency, Such properties of adenosine receptors suggest an expanded understanding of pathogenesis of ADA
SCID
as being due to two independent (intracellular and extracellular) mechanisms of adenosine action. It was conclusively demonstrated that functionally important T cell surface proteins including T cell receptor- are constitutively Ser/Thr phosphorylated on their ectodomains. We identified the major ecto-
protein kinase
activity in T-lymphocytes as
casein kinase II
-like (CKII-like)
protein kinase
. Consensus phosphorylation sites for serine and threonine protein kinases were found to be strongly evolutionary conserved in both alfa and beta TCR chains constant region. We have shown that ecto- or releasable by T-cells protein phosphatase has properties of PP1 and PP2a class protein phosphatase. Such covalent modifications of ectodomains may change T cells cognate interactions by e.g. affecting TCR-multimolecular complex formation and antigen binding affinity. It is suggested that TCR ectodomain phosphorylation could serve as a potential mechanism for regulation of TCR-mediated T-lymphocytes response.
...
PMID:Extracellular purines and their receptors in immunoregulation. Review of recent advances. 980 87
Human hepatocellular carcinoma (HCC) can invade the portal vein and metastasizes to other parts of the liver even at a relatively early stage of the disease, with less tumor spread occurring outside the liver. This intrahepatic metastasis is the main cause of liver failure and death in HCC patients. To analyze the mechanisms of intrahepatic metastasis we have constructed metastatic models using orthotopic implantation of human HCC cell lines. Five HCC cell lines formed liver tumors after injection into the livers of
SCID
mice, and of those 5 cell lines, Li7 and KYN-2 cells also resulted in vascular tumor thrombi and intrahepatic metastasis. These 2 cell lines had markedly higher cell motilities than the other 3 cell lines in vitro. Their motilities appeared to be Rho-mediated; serum and lysophosphatidic acid (LPA) evoked actin reorganization and motility of Li7 cells, and C3 exoenzyme exposure reduced the motility of both serum-stimulated Li7 cells and KYN-2 cells. Dominant negative and active forms of p160 Rho-associated coiled-coil forming
protein kinase
(p160ROCK), one of the downstream effectors of Rho, were separately and stably introduced into Li7 cells. Dominant active p160ROCK transfectants showed increased motility that was independent of serum and LPA, and dominant negative p160ROCK transfectants showed reduced motility under stimulation. Furthermore, implantation of dominant negative p160ROCK transfectants resulted in a reduced metastatic rate in vivo compared with the parent cells or a control transfectant. These findings indicate that cell motility mediated by the Rho/p160ROCK signaling pathway plays a critical role in intrahepatic metastasis of human HCC.
...
PMID:Cell motility mediated by rho and Rho-associated protein kinase plays a critical role in intrahepatic metastasis of human hepatocellular carcinoma. 1049 56
CD8 deficiency is an autosomal recessive form of
severe combined immunodeficiency
diseases characterized by the absence of CD8(+) T lymphocytes and impaired T cell functions. We identified two novel mis-sense mutations in the zap70 genes of a CD8-deficiency patient. One mutation (P80Q) affects a residue in an SH2 domain and another (M572L) in the kinase subdomain XI. Both mutations cause a degradation of ZAP70 protein in a temperature-sensitive manner through an ATP-dependent and proteasome-independent pathway. We further demonstrated that Cdc37, a
protein kinase
-specific chaperone, bound to M572L but not P80Q mutant and restored the expression of the M572L mutant when overexpressed. The restoration of M572L mutant by Cdc37 required the function of HSP90. These results indicate that Cdc37 in conjunction with HSP90 functions as a molecular chaperone for a temperature-sensitive kinase domain mutant of ZAP70.
...
PMID:Temperature-sensitive ZAP70 mutants degrading through a proteasome-independent pathway. Restoration of a kinase domain mutant by Cdc37. 1057 9
DNA-PKcs, the catalytic subunit of DNA-dependent protein kinase (DNA-PK), has a phosphoinositol 3-kinase (PI 3-K) domain close to its C-terminus. Cell lines derived from the
SCID
mouse have been utilised as a model DNA-PKcs-defective system. The
SCID
mutation results in truncation of DNA-Pkcs at the extreme C-terminus leaving the PI 3-K domain intact. The mutated protein is expressed at low levels in most
SCID
cell lines, leaving open the question of whether the mutation abolishes kinase activity. Here, we show that a
SCID
cell line that expresses the mutant protein normally has dramatically impaired kinase activity. We estimate that the residual kinase activity typically present in
SCID
fibroblast cell lines is at least two orders of magnitude less than that found in control cells. Our results substantiate evidence that DNA-PKcs kinase activity is required for DSB rejoining and V(D)J recombination and show that the extreme C-terminal region of DNA-PKcs, present in PI 3-K-related protein kinases but absent in bona fide PI 3 lipid kinases, is required for DNA-PKcs to function as a
protein kinase
. We also show that expression of mutant DNA-PKcs protein confers a growth disadvantage, providing an explanation for the lack of DNA-PKcs expression in most
SCID
cell lines.
...
PMID:The C-terminal conserved domain of DNA-PKcs, missing in the SCID mouse, is required for kinase activity. 1071 Apr 16
6-[3-adamantyl-4-hydroxyphenyl]-2-naphthalene carboxylic acid (CD437) is a novel compound that represents the prototype of a new class of synthetic retinoids with apoptogenic properties in acute promyelocytic leukemia (APL) and other types of leukemia. In this article, using
SCID
mice xenografted with APL-derived NB4 cells, we demonstrate that CD437 has significant antileukemic activity in vivo. In addition, we report on the isolation and characterization of an APL cell line (NB4.437r) resistant to CD437. The cell line retains expression of PML-RARalpha and is approximately 33-fold more resistant than the parental counterpart to the apoptogenic effects of the retinoid. Resistance is relatively specific to CD437 and structural congeners because the NB4.437r cell line is still sensitive to various types of apoptogenic compounds. The CD437-resistant cell line maintains sensitivity to the antiproliferative and apoptotic action of all-trans-retinoic acid, AM580, and fenretinide, though it shows partial resistance to the cytodifferentiating effects of the first 2 compounds. Resistance to CD437 lays upstream of the CD437-induced release of cytochrome c from the mitochondria and the activation of caspase-3, -7, -8, and -9. Furthermore, NB4.437r cells are deficient in the CD437-dependent activation of nuclear NFkb and AP1-binding activities and in the phosphorylation of the
protein kinase
Akt. In the case of AP1, deficient assembly of the complex is not caused by the lack of activation of the Jun N-terminal kinase (JNK) family of kinases. The novel cell line will be useful in the elucidation of the molecular mechanisms underlying the apoptogenic action of CD437 and structurally related retinoids. (Blood. 2000;95:2672-2682)
...
PMID:Isolation and characterization of an acute promyelocytic leukemia cell line selectively resistant to the novel antileukemic and apoptogenic retinoid 6-[3-adamantyl-4-hydroxyphenyl]-2-naphthalene carboxylic acid. 1075 50
The RNase-resistant and membrane-permeable antisense poly-2'-O-(2,4-dinitrophenyl)-oligoribonucleotides (poly-DNP-RNA) against RIalpha subunit of
protein kinase A
(RIalpha/
PKA
) has been used to inhibit the growth of human breast cancer MDA-MB-231 cells in vitro and in vivo. This antisense poly-DNP-RNA, with oligonucleotide sequence GGGCGUGCCUCCUCACUGGC, was found to be an effective concentration-dependent inhibitor of MDA-MB-231 cell line, whereas the control poly-DNP-RNAs with either random or sense sequence were found completely inactive. In situ hybridization studies showed that this antisense inhibitor can permeate spontaneously into MDA-MB-231 cells and distribute itself throughout the cytoplasm. Intraperitoneal administration of this antisense RIalpha poly-DNP-RNA to
SCID
mice with transplanted MDA-MB-231 cells was found to inhibit the growth of the xenografts in a concentration-dependent way, prevent metastasis, and drastically reduce mortality.
...
PMID:Growth inhibition and antimetastatic effect of antisense poly-DNP-RNA on human breast cancer cells. 1090 62
Chronic myelogenous leukemia (CML) is a clonal disorder of a pluripotent hematopoietic stem cells characterized by a chimeric bcr-abl gene giving rise to a p210(Bcr-Abl) protein with dysregulated tyrosine kinase activity. Radicicol, a macrocyclic antifungal antibiotic, binds to the N-terminal of heat shock protein 90 (Hsp90) and destabilizes Hsp90-associated proteins such as
Raf-1
. This study investigated the effect of radicicol, novel oxime derivatives of radicicol (KF25706 and KF58333), and herbimycin A (HA), a benzoquinoid ansamycin antibiotic, on the growth and differentiation of human K562 CML cells. Although KF25706 and KF58333 induced the expression of glycophorin A in K562 cells, radicicol and HA caused erythroid differentiation transiently. Cell cycle analysis showed that G(1) phase accumulation was observed in K562 cells treated with KF58333. KF58333 treatment depleted p210(Bcr-Abl),
Raf-1
, and cellular tyrosine phosphorylated proteins in K562 cells, whereas radicicol and HA showed transient depletion of these proteins. KF58333 also down-regulated the level of cell cycle-dependent kinases 4 and 6 and up-regulated cell cycle-dependent kinase inhibitor p27(Kip1) protein without an effect on the level of Erk and Hsp90 proteins. Immunoprecipitation analysis showed that p210(Bcr-Abl) formed multiple complexes with Hsp90, some containing p23 and others Hsp70; KF58333 treatment dissociated p210(Bcr-Abl) from Hsp90/p23 chaperone complexes. Furthermore, KF58333 induced apoptosis in K562 cells and administration of KF58333 prolonged the survival time of
SCID
mice inoculated with K562 cells. These results suggest that KF58333 may have therapeutic potential for the treatment of CML that involves abnormal cellular proliferation induced by p210(Bcr-Abl).
...
PMID:Novel oxime derivatives of radicicol induce erythroid differentiation associated with preferential G(1) phase accumulation against chronic myelogenous leukemia cells through destabilization of Bcr-Abl with Hsp90 complex. 1097 78
EBV-encoded small RNAs (EBERs) are non-polyadenylated and abundantly transcribed RNAs, whose functions have not yet been fully elucidated. Here, we report that the EBV-negative B lymphoma cell line, BJAB, was rendered more malignant and resistant to apoptosis by EBERs. EBER-transfected cells exhibited enhanced growth potential in
SCID
mice as well as in soft agar, and showed resistance to apoptotic stimuli in comparison with the vector control. EBERs inhibited the activity of the double-stranded RNA-dependent
protein kinase
, PKR, which is reputed to act as a tumor-suppressor. These results suggest that EBERs play an important role in the pathogenesis of EBV-associated malignancies through the inhibition of PKR.
...
PMID:Malignant transformation of B lymphoma cell line BJAB by Epstein-Barr virus-encoded small RNAs. 1106 51
1
2
3
4
5
6
7
Next >>