Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.1.21 (thymidine kinase)
7,561 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

To understand smooth muscle-specific gene expression, we have focused our studies on the smooth muscle myosin heavy chain (SMHC) gene, a smooth muscle-specific marker. In this study, we demonstrate that the SMHC promoter region (-1594 to -1462 base pairs) containing the A/T-rich element can activate the heterologous thymidine kinase promoter in smooth muscle cells, but not in fibroblasts. Mutations of this A/T-rich element decreased SMHC promoter activity significantly. Both gel mobility shift assays and DNase I footprinting revealed that this region binds to specific protein complexes from smooth muscle nuclear extracts, whereas nuclear extracts from skeletal muscle and fibroblasts produced a different binding pattern. We also demonstrate that the protein complex obtained from smooth muscle nuclear extract reacts with MEF2B-specific antibody, but not with antibodies specific to MEF2A, MEF2C, or MEF2D, suggesting that only MEF2B protein binds to the A/T-rich element. Furthermore, MEF2B overexpression in smooth muscle cells up-regulated the SMHC promoter, suggesting that MEF2B is important for SMHC gene regulation. This is the first report demonstrating a role for MEF2 factors in smooth muscle-specific gene expression.
...
PMID:MEF2B is a component of a smooth muscle-specific complex that binds an A/T-rich element important for smooth muscle myosin heavy chain gene expression. 943 Jun 90

Induction of cytochrome (CYP) P4501A2 by such polycyclic aromatic hydrocarbons as 3-methylcholanthrene (3MC) can lead to the bioactivation of carcinogenic aromatic amines and heterocyclic amines. A 3MC response element was recently identified approximately 2.2 kb upstream of the transcription start site of the human CYP1A2 gene. Sequence analysis of this enhancer identified, in addition to a binding site for the aryl hydrocarbon receptor, two other sequences, referred to as 5'AP1 and 3'AP1, each with complete homology to the phorbol 12-O-tetradecanoate 13-acetate (TPA) response element consensus sequence. Nuclear extracts from TPA-treated HepG2 cells protected both the 5'AP1 and 3'AP1 sequences against digestion with DNase I. Gel mobility shift and supershift assays revealed that TPA treatment of HepG2 results in increased binding activity of the AP-1 proteins, c-Jun, JunD, and c-Fos, to both sites. We transiently expressed, in HepG2, either a fragment containing both the 5'AP1 and 3'AP1 sites (-2.3pT81Luc) or only the 3'AP1 site (-2.2pT81Luc) cloned into a plasmid containing the luciferase gene under transcriptional control of the thymidine kinase promoter. TPA treatment of cells transfected with -2.3pT81Luc resulted in an approximately threefold induction of luciferase activity over untreated control cells, while the -2.2pT81Luc construction containing only the 3'AP1 site displayed an approximately sixfold induction. These studies suggest that the human CYP1A2 gene may be regulated by tumor promoters in addition to polycyclic aromatic hydrocarbons.
...
PMID:Induction of the human CYP1A2 enhancer by phorbol ester. 946 18

A monkey kidney cDNA that encodes a nuclear regulatory factor was identified by expression and affinity binding to a synthetic retinoic acid response element (RARE) and was used to isolate human placental and rat germ cell cDNAs by hybridization. The cDNAs encode a 59-kDa protein [nuclear DEAF-1-related (NUDR)] which shows sequence similarity to the Drosophila Deformed epidermal autoregulatory factor-1 (DEAF-1), a nonhomeodomain cofactor of embryonic Deformed gene expression. Similarities to other proteins indicate five functional domains in NUDR including an alanine-rich region prevalent in developmental transcription factors, a domain found in the promyelocytic leukemia-associated SP100 proteins, and a zinc finger homology domain associated with the AML1/MTG8 oncoprotein. Although NUDR mRNA displayed a wide tissue distribution in rats, elevated levels of protein were only observed in testicular germ cells, developing fetus, and transformed cell lines. Nuclear localization of NUDR was demonstrated by immunocytochemistry and by a green fluorescent protein-NUDR fusion protein. Site-directed mutagenesis of a nuclear localization signal resulted in cytoplasmic localization of the protein and eliminated NUDR-dependent transcriptional activation. Recombinant NUDR protein showed affinity for the RARE in mobility shifts; however it was efficiently displaced by retinoic acid receptor (RAR)/retinoid X receptor (RXR) complexes. In transient transfections, NUDR produced up to 26-fold inductions of a human proenkephalin promoter-reporter plasmid, with minimal effects on the promoters for prodynorphin or thymidine kinase. Placement of a RARE on the proenkephalin promoter increased NUDR-dependent activation to 41-fold, but this RARE-dependent increase was not transferable to a thymidine kinase promoter. Recombinant NUDR protein showed minimal binding affinity for proenkephalin promoter sequences, but was able to select DNA sequences from a random oligonucleotide library that had similar core-binding motifs (TTCG) as those recognized by DEAF-1. This motif is also present between the half-sites of several endogenous RAREs. The derived consensus- binding motif recognized by NUDR (TTCGGGNNTTTCCGG) was confirmed by mobility shift and deoxyribonuclease I (DNase I) protection assays; however, the consensus sequence was also unable to confer NUDR-dependent transcriptional activation to the thymidine kinase promoter. Our data suggests that NUDR may activate transcription independently of promoter binding, perhaps through protein-protein interaction with basal transcription factors, or by activation of secondary factors. The sequence and functional similarities between NUDR and DEAF-1 suggest that NUDR may also act as a cofactor to regulate the transcription of genes during fetal development or differentiation of testicular cells.
...
PMID:Characterization of a nuclear deformed epidermal autoregulatory factor-1 (DEAF-1)-related (NUDR) transcriptional regulator protein. 977 84

The coding region of the human histone H4 gene FO108 undergoes dynamic changes in chromatin structure that correlate with modifications in gene expression. Such structural alterations generally reflect transcription factor interactions with gene regulatory sequences. To test for regulatory elements within the coding region, we performed transient transfection experiments in HeLa cells using constructs with histone H4 sequences fused upstream of a heterologous thymidine kinase promoter and CAT reporter gene. H4 gene sequences from -10 to +210 repressed transcription 4.8-fold. Further deletion and mutational analysis delineated three repressor elements within this region. Using oligonucleotide competition analysis and specific antibody recognition in electrophoretic mobility shift assays, as well as methylation interference and DNase I footprinting analyses, we have identified the CCAAT displacement protein (CDP/cut) as the factor that interacts with these three repressor elements. CDP/cut binding to these repressor sites is proliferation-specific and cell-cycle-regulated, increasing in mid to late S phase. Our results indicate that the proximal 200 nucleotides of the histone H4-coding region contain transcriptional regulatory elements that may contribute to cell-cycle control of histone gene expression by interacting with repressor complexes containing CDP/cut homeodomain transcription factors.
...
PMID:Repressor elements in the coding region of the human histone H4 gene interact with the transcription factor CDP/cut. 987 97

The position-independent expression of transgenes in target cells is an essential subject for determining effective gene therapies. The chicken beta-globin insulator blocks the effects of regulatory sequences on transcriptional units at differential domains. We prepared a recombinant adeno-associated virus (rAAV) containing various combinations of the DNase I-hypersensitive site 2 (HS2), 3 (HS3), and 4 (HS4) core elements from the human beta-globin locus control region (LCR), the human beta-globin gene, and the herpes virus thymidine kinase promoter driven neomycin-resistant gene (neoR) (rHS432, rHS43, rHS42, rHS32, and rHS2), and also rAAV containing two copies of the 250-bp core sequence of the chicken beta-globin insulator on both sides of the rHS2 (rIns/HS2/2Ins). After isolating neomycin-resistant mouse erythroleukemia (MEL) cells infected with each rAAV, we analyzed the rAAV genome by Southern blots and polymerase chain reaction (PCR), using primers specific for HS core elements and the human beta-globin gene. All clones contained a single copy of the rAAV genome in the chromosome, however, some of them had a rearranged proviral genome. In five clones with a single unrearranged rAAV genome for each rAAV construct, we assayed the expression of the human b-globin gene relative to the endogenous mouse beta maj-globin gene, using quantitative reverse transcriptase (RT)-PCR. In clones infected with rHS432, the expression level of the human beta-globin gene ranged from 51.6% to 765.6% of that in the mouse beta maj-globin gene. Likewise, in rHS43, the expression level ranged from 36.7% to 259.0%; in rHS42, from 47.8% to 207.0%; in rHS32, from 47.9% to 105.4%; and in rHS2, from 6.1% to 172.1%, indicating a high variability of expression level in clones infected with recombinant virus lacking the insulator. In contrast, in clones infected with rIns/HS2/Ins, the range of expression of the human beta-globin gene ranged from 52.8% to 58.3% of that in the mouse beta maj-globin gene. These results indicate that the insulator functioned dramatically to reduce the variability of transgene expression due to the position effect. This insulator-rAAV vector system holds promise to provide a constant level of transgene expression for gene therapy, regardless of the insertion sites on the chromosome.
...
PMID:Position-independent human beta-globin gene expression mediated by a recombinant adeno-associated virus vector carrying the chicken beta-globin insulator. 1031 78

Peripherin is an intermediate filament protein expressed in restricted populations of neurons. Our previous study of the chromatin structure of the mouse peripherin gene in cells that do or do not express peripherin suggested that the region located between -1,500 and +800 bp of the gene could be involved in its cell specificity. In the present work, we performed an in vitro functional analysis of the 5' flanking region of the mouse peripherin gene and observed that this region up to 9 kb contained both enhancer and inhibiting activities; however, it was insufficient to achieve a complete extinction of reporter gene expression in peripherin-negative cells. Furthermore, analysis of the first three introns with the 5' flanking sequences of the gene showed that intron I greatly increased specificity of the gene expression. Intron I also conferred the same properties to thymidine kinase heterologous promoter. DNase I footprinting experiments performed with intron I revealed at least two protected regions (Inl A and Inl B). Inl A encompasses an AP-2-like binding site that interacted with both neuroblast and fibroblast nuclear factors, as well as with the recombinant AP-2alpha protein. However, gel shift experiments suggested that the interacting nuclear factors are distinct from AP-2alpha itself and probably belong to the AP-2 family. Inl B perfectly matched the consensus binding site for Sp1 and specifically interacted with nuclear protein factors that showed the same binding properties as the Sp1 family members. Fine deletion analysis of intron I indicated that the Inl A element alone is responsible for its enhancing properties, whereas a region located between +789 and +832 gives to intron I its silencer activity.
...
PMID:Involvement of intronic sequences in cell-specific expression of the peripherin gene. 1053 38

L-Plastin is normally a leukocyte-specific actin-binding protein; it is also expressed in the majority of human cancer cell lines that are derived from many types of solid tumors. We have previously reported the isolation of the L-plastin gene promoter, in which we identified several potential steroid receptor-binding sequences. We now obtained evidence that L-plastin gene expression was positively regulated by testosterone in androgen receptor (AR)-positive prostate and breast cancer cells. DNase I footprint analysis identified three AR-binding elements (ARE) located in a 545-bp region approximately 1.1 kb upstream from the transcription initiation site. However, each of these three AREs exhibited very little testosterone/AR-responsive enhancer activities toward a test promoter (of the thymidine kinase gene) when tested in MCF-7 breast cancer cells. Their testosterone/AR responsiveness became evident only when two or three of them were combined. In PC-3 prostate cancer cells, cooperation among L-plastin AREs was still evident although individually they had moderate levels of testosterone/AR responsiveness. Thus, the three L-plastin AREs, despite their imperfect sequences compared with the consensus ARE, could cooperate with each other to become a potent testosterone/AR-responsive unit, which was likely responsible for the inducibility of the L-plastin gene by testosterone.
...
PMID:Upregulation of L-plastin gene by testosterone in breast and prostate cancer cells: identification of three cooperative androgen receptor-binding sequences. 1066 86

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97

Deletion analysis of the human PRL promoter in endometrial stromal cells decidualized in vitro revealed a 536-bp enhancer located between nucleotide (nt) -2,040 to -1,505 in the 5'-flanking region. The 536-bp enhancer fragment ligated into a thymidine kinase (TK) promoter-luciferase reporter plasmid conferred enhancer activity in decidual-type cells but not nondecidual cells. DNase I footprint analysis of decidualized endometrial stromal cells revealed three protected regions, FP1-FP3. Transfection of overlapping 100-bp fragments of the 536-bp enhancer indicated that FP1 and FP3 each conferred enhancer activity. Gel shift assays indicated that both FP1 and FP3 bind activator protein 1 (AP-1), and JunD and Fra-2 are components of the AP-1 complex in decidual fibroblasts. Mutation of the AP-1 binding site in either FP1 or FP3 decreased enhancer activity by approximately 50%, while mutation of both sites almost completely abolished activity. Coexpression of the 536-bp enhancer and A-fos, a dominant negative to AP-1, decreased enhancer activity by approximately 70%. Conversely, coexpression of Fra-2 in combination with JunD or c-Jun and p300 increased enhancer activity 6- to 10-fold. Introduction of JunD and Fra-2 into nondecidual cells is sufficient to confer enhancer activity. JunD and Fra-2 protein expression was markedly increased in secretory phase endometrium and decidua of early pregnancy (high PRL content) compared with proliferative phase endometrium (no PRL). These investigations indicate that the 5'-flanking region of the human PRL gene contains a decidua-specific enhancer between nt -2,040/-1,505 and AP-1 binding sites within this enhancer region are critical for activity.
...
PMID:Identification of a decidua-specific enhancer on the human prolactin gene with two critical activator protein 1 (AP-1) binding sites. 1126 14

The norepinephrine transporter (NET) is responsible for the rapid NaCl-dependent uptake of norepinephrine into presynaptic noradrenergic nerve endings. Recently, we have characterized the structural organization of the 5' upstream promoter region of the human NET (hNET) gene. A new intron of 476 base pairs was found in the middle of the 5'-untranslated leader sequence and was shown to robustly enhance the promoter activity. Here, we show that the first hNET intron enhances both the homologous hNET and the heterologous thymidine kinase promoter activities in an orientation- and position-dependent manner. The first hNET intron exhibited a similar promoter-enhancing effect in both SK-N-BE(2)C (NET-positive) and HeLa (NET-negative) cell lines, showing that its function is not cell-specific. Transient transfection assays of a series of deletional constructs show that the first hNET intron contains subdomains with either positive or negative regulatory functions. Furthermore, DNase I footprinting analysis demonstrated that the 5' side of the intron, encompassing the splice donor site, is prominently protected by nuclear proteins isolated from both SK-N-BE(2)C and HeLa cells. The protected nucleotide sequence contains a consensus E-box motif, known to regulate diverse eukaryotic genes, which overlaps with the splice donor site of the first intron. We demonstrate that two basic helix-loop-helix proteins, upstream stimulatory factors 1 and 2, are major proteins interacting at this site and that the E-box is at least in part responsible for the promoter-enhancing activity of the first intron. Furthermore, site-directed mutagenesis of the splice donor site of the first intron affects both correct splicing and transcriptional activity. Taken together, our results indicate that a cis-element residing at the first exon/intron junction, encompassing an E-box motif, has a unique dual role in basal transcriptional activation and splicing of hNET mRNA.
...
PMID:An E-box motif residing in the exon/intron 1 junction regulates both transcriptional activation and splicing of the human norepinephrine transporter gene. 1133 63


<< Previous 1 2 3 4 5 6 7 8 Next >>