Gene/Protein Disease Symptom Drug Enzyme Compound
Pivot Concepts:   Target Concepts:
Query: EC:2.7.1.21 (thymidine kinase)
 7,561 document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)

Serum thymidine kinase (STK) levels have recently been used to detect tumour regression and progression in a number of hematological malignancies. In this study, patients with myeloma were monitored longitudinally for STK and several other potentially useful tumour markers to determine which laboratory parameters are the most useful for differentiating between stable and progressive disease. STK was determined by radioenzyme assay, lymphocyte surface markers were analysed by flowcytometry, plasma cell labelling index (LI) by immunofluorescence with anti BU-1, serum B2-microglobulin (SB2M) by radioimmunoassay and M proteins by radial immunodiffusion. Detailed multiparameter longitudinal investigations of 5 patients and ongoing studies of 70 other patients suggest that STK is a more reliable marker of progressive disease than either SB2M, LI, M-protein or CD10 positive lymphocytes. A rise in STK during the emergence of progressive disease at least paralleled and usually preceded any change in the other parameters which often did not change at all. All samples from patients with progressive disease (n = 29) had a STK above the normal range (0-5U/l) whereas 76% of patients in clear stable disease had a STK within the normal range. All samples (n = 34) from patients with light chain isotype suppression (LCIS) had STK values of less than 12 U/L and 82% of samples (n = 33) from patients without LCIS had a STK above the normal range (0-5U/L). The correlation between STK and LI was r = 0.65; p less than 0.001 (n = 21). The radioenzyme assay for STK is simple, reproducible and a valuable tool for monitoring patients with myeloma and when used in conjunction with other clinical and laboratory investigations, aids in the separation of patients with stable myeloma from patients whose disease is progressive.
 ...
PMID:Serum thymidine kinase as a marker of disease activity in patients with multiple myeloma. 252 40

Transcription of the human neutral endopeptidase 24.11 (NEP) gene is androgen regulated in prostate cancer cells. Homology search identified a sequence GTCACAaagAGTTCT similar to the ARE consensus sequence GGTACAnnnTGTTCT within the 3'-untranslated region of the NEP mRNA. A double-stranded radiolabelled oligonucleotide containing this NEP-ARE sequence formed a DNA-protein complex with nuclear proteins from LNCaP cells or COS-7 cells co-transfected with an androgen receptor (AR) expression vector, and with full-length AR synthesized by baculovirus in mobility shift assays. Unlabeled NEP-ARE or consensus ARE but not mutated NEP-ARE replaced radiolabelled NEP-ARE. Steroid-dependent enhancement of transcription was assayed by transfecting ptkCAT reporter constructs containing the NEP-ARE into CV-1/AR cells and prostate cancer cells (PC-3/AR). Enhancement of chloramphenicol acetyltransferase (CAT) activity was increased four-fold by androgen, seven-fold by dexamethasone and three-fold by progesterone in CV-1/AR cells, and the NEP-ARE bound to glucocorticoid and progesterone receptor in mobility shift assays. We next performed DNase-I footprinting analysis of the NEP promoter and identified a 23 bp sequence GGTGCGGGTCGGAGGGATGCCCA (NEP-ARR) which was protected from DNase I cleavage by nuclear extracts from COS-7 cells expressing AR. This sequence was 62.5% homologous to an androgen responsive region (PSA-ARR) identified in the promoter of the prostate specific antigen (PSA) gene. A double-stranded radiolabelled oligonucleotide containing this NEP-ARR sequence formed DNA-protein complex with AR but not GR proteins. Unlabeled NEP-ARR, PSA-ARR and NEP-ARE replaced radiolabelled NEP-ARR. Steroid-dependent enhancement of transcription assays in PC-3/AR cells revealed that the enhancement of CAT activity was increased 2.3-fold by androgen, but not by glucocorticoid or progesterone. In a thymidine kinase promoter, the NEP-ARE and NEP-ARR together stimulated a five-fold increase in promoter activity in PC cells. These data suggest that steroid regulation of the NEP gene involves at least two elements including a typical ARE which binds androgen, progesterone and glucocorticoid receptors, and a unique ARR which only binds androgen receptor.
 ...
PMID:Identification and characterization of two androgen response regions in the human neutral endopeptidase gene. 1116 97